ID: 1002740682

View in Genome Browser
Species Human (GRCh38)
Location 5:181433213-181433235
Sequence GGGGTAAATTATCCTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002740682_1002740694 26 Left 1002740682 5:181433213-181433235 CCAAGCTCAGGATAATTTACCCC No data
Right 1002740694 5:181433262-181433284 GGCTGGAAGGCCCCGAGCACAGG No data
1002740682_1002740692 9 Left 1002740682 5:181433213-181433235 CCAAGCTCAGGATAATTTACCCC No data
Right 1002740692 5:181433245-181433267 TGCACTGCAGAAGGTCTGGCTGG No data
1002740682_1002740693 13 Left 1002740682 5:181433213-181433235 CCAAGCTCAGGATAATTTACCCC No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data
1002740682_1002740691 5 Left 1002740682 5:181433213-181433235 CCAAGCTCAGGATAATTTACCCC No data
Right 1002740691 5:181433241-181433263 AGGGTGCACTGCAGAAGGTCTGG No data
1002740682_1002740689 0 Left 1002740682 5:181433213-181433235 CCAAGCTCAGGATAATTTACCCC No data
Right 1002740689 5:181433236-181433258 CTACCAGGGTGCACTGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002740682 Original CRISPR GGGGTAAATTATCCTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr