ID: 1002740685

View in Genome Browser
Species Human (GRCh38)
Location 5:181433232-181433254
Sequence CTGCAGTGCACCCTGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002740685_1002740692 -10 Left 1002740685 5:181433232-181433254 CCCCCTACCAGGGTGCACTGCAG No data
Right 1002740692 5:181433245-181433267 TGCACTGCAGAAGGTCTGGCTGG No data
1002740685_1002740693 -6 Left 1002740685 5:181433232-181433254 CCCCCTACCAGGGTGCACTGCAG No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data
1002740685_1002740694 7 Left 1002740685 5:181433232-181433254 CCCCCTACCAGGGTGCACTGCAG No data
Right 1002740694 5:181433262-181433284 GGCTGGAAGGCCCCGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002740685 Original CRISPR CTGCAGTGCACCCTGGTAGG GGG (reversed) Intergenic
No off target data available for this crispr