ID: 1002740687

View in Genome Browser
Species Human (GRCh38)
Location 5:181433234-181433256
Sequence TTCTGCAGTGCACCCTGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002740687_1002740694 5 Left 1002740687 5:181433234-181433256 CCCTACCAGGGTGCACTGCAGAA No data
Right 1002740694 5:181433262-181433284 GGCTGGAAGGCCCCGAGCACAGG No data
1002740687_1002740698 29 Left 1002740687 5:181433234-181433256 CCCTACCAGGGTGCACTGCAGAA No data
Right 1002740698 5:181433286-181433308 GTTGATTGCTAGCTGCTAAGAGG No data
1002740687_1002740693 -8 Left 1002740687 5:181433234-181433256 CCCTACCAGGGTGCACTGCAGAA No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002740687 Original CRISPR TTCTGCAGTGCACCCTGGTA GGG (reversed) Intergenic
No off target data available for this crispr