ID: 1002740693

View in Genome Browser
Species Human (GRCh38)
Location 5:181433249-181433271
Sequence CTGCAGAAGGTCTGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002740685_1002740693 -6 Left 1002740685 5:181433232-181433254 CCCCCTACCAGGGTGCACTGCAG No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data
1002740682_1002740693 13 Left 1002740682 5:181433213-181433235 CCAAGCTCAGGATAATTTACCCC No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data
1002740688_1002740693 -9 Left 1002740688 5:181433235-181433257 CCTACCAGGGTGCACTGCAGAAG No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data
1002740686_1002740693 -7 Left 1002740686 5:181433233-181433255 CCCCTACCAGGGTGCACTGCAGA No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data
1002740687_1002740693 -8 Left 1002740687 5:181433234-181433256 CCCTACCAGGGTGCACTGCAGAA No data
Right 1002740693 5:181433249-181433271 CTGCAGAAGGTCTGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002740693 Original CRISPR CTGCAGAAGGTCTGGCTGGA AGG Intergenic
No off target data available for this crispr