ID: 1002747685

View in Genome Browser
Species Human (GRCh38)
Location 6:74437-74459
Sequence ATACAGAAAAGGAAAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002747680_1002747685 11 Left 1002747680 6:74403-74425 CCCATGGTAACCACTAAGTTAAT No data
Right 1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG No data
1002747681_1002747685 10 Left 1002747681 6:74404-74426 CCATGGTAACCACTAAGTTAATA No data
Right 1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG No data
1002747679_1002747685 12 Left 1002747679 6:74402-74424 CCCCATGGTAACCACTAAGTTAA No data
Right 1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG No data
1002747682_1002747685 1 Left 1002747682 6:74413-74435 CCACTAAGTTAATATCTTTTGAA No data
Right 1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002747685 Original CRISPR ATACAGAAAAGGAAAGCAGA GGG Intergenic
No off target data available for this crispr