ID: 1002748539

View in Genome Browser
Species Human (GRCh38)
Location 6:86968-86990
Sequence CTTTCCCCCATCGCAGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002748534_1002748539 29 Left 1002748534 6:86916-86938 CCTTCACAGCCATATTGTGGAAA No data
Right 1002748539 6:86968-86990 CTTTCCCCCATCGCAGCCTCGGG No data
1002748537_1002748539 3 Left 1002748537 6:86942-86964 CCTCAGCAGTATGTGCTGGAATT No data
Right 1002748539 6:86968-86990 CTTTCCCCCATCGCAGCCTCGGG No data
1002748535_1002748539 20 Left 1002748535 6:86925-86947 CCATATTGTGGAAAACACCTCAG No data
Right 1002748539 6:86968-86990 CTTTCCCCCATCGCAGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002748539 Original CRISPR CTTTCCCCCATCGCAGCCTC GGG Intergenic
No off target data available for this crispr