ID: 1002758886

View in Genome Browser
Species Human (GRCh38)
Location 6:186562-186584
Sequence CTGAAAACACAGAAGTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002758882_1002758886 26 Left 1002758882 6:186513-186535 CCATCACAGCTGCTCTGTGACTA 0: 1
1: 1
2: 1
3: 28
4: 242
Right 1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG No data
1002758881_1002758886 27 Left 1002758881 6:186512-186534 CCCATCACAGCTGCTCTGTGACT 0: 1
1: 0
2: 0
3: 28
4: 266
Right 1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002758886 Original CRISPR CTGAAAACACAGAAGTACAA AGG Intergenic
No off target data available for this crispr