ID: 1002758886 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:186562-186584 |
| Sequence | CTGAAAACACAGAAGTACAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1002758882_1002758886 | 26 | Left | 1002758882 | 6:186513-186535 | CCATCACAGCTGCTCTGTGACTA | 0: 1 1: 1 2: 1 3: 28 4: 242 |
||
| Right | 1002758886 | 6:186562-186584 | CTGAAAACACAGAAGTACAAAGG | No data | ||||
| 1002758881_1002758886 | 27 | Left | 1002758881 | 6:186512-186534 | CCCATCACAGCTGCTCTGTGACT | 0: 1 1: 0 2: 0 3: 28 4: 266 |
||
| Right | 1002758886 | 6:186562-186584 | CTGAAAACACAGAAGTACAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1002758886 | Original CRISPR | CTGAAAACACAGAAGTACAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||