ID: 1002761797

View in Genome Browser
Species Human (GRCh38)
Location 6:208267-208289
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002761797_1002761801 1 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761801 6:208291-208313 TAGAGTAGAAATGATGCTCTGGG No data
1002761797_1002761806 26 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761806 6:208316-208338 AATACCCCCTGGGCAGGTGGTGG No data
1002761797_1002761802 15 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761802 6:208305-208327 TGCTCTGGGAAAATACCCCCTGG No data
1002761797_1002761803 16 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761803 6:208306-208328 GCTCTGGGAAAATACCCCCTGGG No data
1002761797_1002761804 20 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761804 6:208310-208332 TGGGAAAATACCCCCTGGGCAGG No data
1002761797_1002761805 23 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761805 6:208313-208335 GAAAATACCCCCTGGGCAGGTGG No data
1002761797_1002761800 0 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761800 6:208290-208312 GTAGAGTAGAAATGATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002761797 Original CRISPR AAAGAATTTTAAATTTTGTG GGG (reversed) Intergenic