ID: 1002761799

View in Genome Browser
Species Human (GRCh38)
Location 6:208269-208291
Sequence ACAAAGAATTTTAAATTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002761799_1002761806 24 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761806 6:208316-208338 AATACCCCCTGGGCAGGTGGTGG No data
1002761799_1002761800 -2 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761800 6:208290-208312 GTAGAGTAGAAATGATGCTCTGG No data
1002761799_1002761801 -1 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761801 6:208291-208313 TAGAGTAGAAATGATGCTCTGGG No data
1002761799_1002761805 21 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761805 6:208313-208335 GAAAATACCCCCTGGGCAGGTGG No data
1002761799_1002761802 13 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761802 6:208305-208327 TGCTCTGGGAAAATACCCCCTGG No data
1002761799_1002761804 18 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761804 6:208310-208332 TGGGAAAATACCCCCTGGGCAGG No data
1002761799_1002761803 14 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761803 6:208306-208328 GCTCTGGGAAAATACCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002761799 Original CRISPR ACAAAGAATTTTAAATTTTG TGG (reversed) Intergenic
No off target data available for this crispr