ID: 1002761801

View in Genome Browser
Species Human (GRCh38)
Location 6:208291-208313
Sequence TAGAGTAGAAATGATGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002761798_1002761801 0 Left 1002761798 6:208268-208290 CCCACAAAATTTAAAATTCTTTG No data
Right 1002761801 6:208291-208313 TAGAGTAGAAATGATGCTCTGGG No data
1002761797_1002761801 1 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761801 6:208291-208313 TAGAGTAGAAATGATGCTCTGGG No data
1002761799_1002761801 -1 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761801 6:208291-208313 TAGAGTAGAAATGATGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002761801 Original CRISPR TAGAGTAGAAATGATGCTCT GGG Intergenic
No off target data available for this crispr