ID: 1002761803

View in Genome Browser
Species Human (GRCh38)
Location 6:208306-208328
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002761798_1002761803 15 Left 1002761798 6:208268-208290 CCCACAAAATTTAAAATTCTTTG No data
Right 1002761803 6:208306-208328 GCTCTGGGAAAATACCCCCTGGG No data
1002761797_1002761803 16 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761803 6:208306-208328 GCTCTGGGAAAATACCCCCTGGG No data
1002761799_1002761803 14 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761803 6:208306-208328 GCTCTGGGAAAATACCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002761803 Original CRISPR GCTCTGGGAAAATACCCCCT GGG Intergenic