ID: 1002761806

View in Genome Browser
Species Human (GRCh38)
Location 6:208316-208338
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002761799_1002761806 24 Left 1002761799 6:208269-208291 CCACAAAATTTAAAATTCTTTGT No data
Right 1002761806 6:208316-208338 AATACCCCCTGGGCAGGTGGTGG No data
1002761798_1002761806 25 Left 1002761798 6:208268-208290 CCCACAAAATTTAAAATTCTTTG No data
Right 1002761806 6:208316-208338 AATACCCCCTGGGCAGGTGGTGG No data
1002761797_1002761806 26 Left 1002761797 6:208267-208289 CCCCACAAAATTTAAAATTCTTT No data
Right 1002761806 6:208316-208338 AATACCCCCTGGGCAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002761806 Original CRISPR AATACCCCCTGGGCAGGTGG TGG Intergenic