ID: 1002761820

View in Genome Browser
Species Human (GRCh38)
Location 6:208393-208415
Sequence TCCCCATGTTGTGTGAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002761820_1002761822 1 Left 1002761820 6:208393-208415 CCTGCTCTCACACAACATGGGGA No data
Right 1002761822 6:208417-208439 AACGTTGACGCGTTCTTGGTAGG No data
1002761820_1002761823 13 Left 1002761820 6:208393-208415 CCTGCTCTCACACAACATGGGGA No data
Right 1002761823 6:208429-208451 TTCTTGGTAGGCAGTGCAGTAGG No data
1002761820_1002761821 -3 Left 1002761820 6:208393-208415 CCTGCTCTCACACAACATGGGGA No data
Right 1002761821 6:208413-208435 GGATAACGTTGACGCGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002761820 Original CRISPR TCCCCATGTTGTGTGAGAGC AGG (reversed) Intergenic
No off target data available for this crispr