ID: 1002762132

View in Genome Browser
Species Human (GRCh38)
Location 6:210328-210350
Sequence GGCCAATGGTCTGAGGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002762132_1002762138 8 Left 1002762132 6:210328-210350 CCCACACCCTCAGACCATTGGCC No data
Right 1002762138 6:210359-210381 ACGTGTGTTGCAAAATATCAAGG No data
1002762132_1002762139 22 Left 1002762132 6:210328-210350 CCCACACCCTCAGACCATTGGCC No data
Right 1002762139 6:210373-210395 ATATCAAGGATTCAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002762132 Original CRISPR GGCCAATGGTCTGAGGGTGT GGG (reversed) Intergenic
No off target data available for this crispr