ID: 1002764384

View in Genome Browser
Species Human (GRCh38)
Location 6:226713-226735
Sequence CCTTCCATGAAAAGTCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002764384_1002764390 4 Left 1002764384 6:226713-226735 CCATGCAGACTTTTCATGGAAGG No data
Right 1002764390 6:226740-226762 GGCAGGGACTTCTGACACTGAGG No data
1002764384_1002764393 17 Left 1002764384 6:226713-226735 CCATGCAGACTTTTCATGGAAGG No data
Right 1002764393 6:226753-226775 GACACTGAGGCCCTGAGTTGGGG No data
1002764384_1002764392 16 Left 1002764384 6:226713-226735 CCATGCAGACTTTTCATGGAAGG No data
Right 1002764392 6:226752-226774 TGACACTGAGGCCCTGAGTTGGG No data
1002764384_1002764391 15 Left 1002764384 6:226713-226735 CCATGCAGACTTTTCATGGAAGG No data
Right 1002764391 6:226751-226773 CTGACACTGAGGCCCTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002764384 Original CRISPR CCTTCCATGAAAAGTCTGCA TGG (reversed) Intergenic
No off target data available for this crispr