ID: 1002767185

View in Genome Browser
Species Human (GRCh38)
Location 6:252167-252189
Sequence CTGAACAATTCTAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002767185_1002767189 7 Left 1002767185 6:252167-252189 CCTTCCTCCTTAGAATTGTTCAG No data
Right 1002767189 6:252197-252219 GTTATTTCTTCCCTGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002767185 Original CRISPR CTGAACAATTCTAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr