ID: 1002772363

View in Genome Browser
Species Human (GRCh38)
Location 6:300871-300893
Sequence GACTCAGGGGCAACCTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002772357_1002772363 -3 Left 1002772357 6:300851-300873 CCTGGAAGGCTGGAGAGCCAGAC 0: 1
1: 0
2: 3
3: 36
4: 314
Right 1002772363 6:300871-300893 GACTCAGGGGCAACCTTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
1002772353_1002772363 21 Left 1002772353 6:300827-300849 CCTTAGGTAGAACAGGGCAGACA 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1002772363 6:300871-300893 GACTCAGGGGCAACCTTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002772363 Original CRISPR GACTCAGGGGCAACCTTGGC AGG Intronic
901320234 1:8335599-8335621 GACTCACGGGGAGGCTTGGCCGG - Intronic
901654585 1:10762112-10762134 CACTCAGGTCCAACCTTGGGAGG - Intronic
903323530 1:22556412-22556434 GTCTCAGCGGCACTCTTGGCTGG - Intergenic
903759620 1:25688908-25688930 GTCTCAGGAGTAGCCTTGGCAGG + Intronic
905638764 1:39574662-39574684 GTCTCAGCCGCAACCTGGGCAGG + Intronic
905937608 1:41837269-41837291 GACTGAGGGGCTGCCTTTGCTGG - Intronic
908391916 1:63690970-63690992 GACCCAGGGATAAGCTTGGCTGG - Intergenic
910715793 1:90228267-90228289 GATTCAGGGGCAACCTTGTGAGG - Intergenic
913133328 1:115863203-115863225 GACTCAGGAGAAAGTTTGGCAGG + Intergenic
913178819 1:116299519-116299541 GTTTCAGGTGCAGCCTTGGCAGG - Intergenic
913236701 1:116791179-116791201 GACTCAGGGGAAAGCGTGGGAGG + Intergenic
915563358 1:156700440-156700462 GACTCAAGAACAACCATGGCTGG - Intronic
923007021 1:230058211-230058233 CACTCAGGGGCAGCCTGGGCTGG + Intronic
923905882 1:238383181-238383203 AACTCAGGGGAAACACTGGCGGG - Intergenic
924380909 1:243463508-243463530 GACACAGGAGCAGCCCTGGCTGG - Intronic
1062932267 10:1361126-1361148 ACCTTAGGTGCAACCTTGGCAGG - Intronic
1064327430 10:14364172-14364194 GACACTGGGGCAGCCCTGGCTGG - Intronic
1066560540 10:36665031-36665053 GACTCGGGGGAAAACTTGGGAGG + Intergenic
1067242471 10:44508280-44508302 GACACATGGGAAACCATGGCTGG + Intergenic
1068636765 10:59356661-59356683 GGCACATGGGCGACCTTGGCTGG - Intronic
1069863893 10:71488386-71488408 GACTCAGGTCCAAGATTGGCAGG - Intronic
1073526549 10:104188662-104188684 CACTCTGGGGCCACCCTGGCTGG - Intronic
1076135271 10:128041225-128041247 GAGTCAGGGTCAGCCTTGGCTGG + Intronic
1078091933 11:8269326-8269348 GACTCCGTGGCTACCGTGGCAGG + Intergenic
1078196176 11:9138678-9138700 CCCTCAGGGGCATCCTGGGCAGG + Intergenic
1083642500 11:64153089-64153111 GACTCGGGGTCCACCCTGGCCGG + Intronic
1084553385 11:69862382-69862404 GGCTCAGTAGCAACCTTTGCGGG - Intergenic
1084708063 11:70827313-70827335 GAATCGGGGCCATCCTTGGCAGG - Intronic
1086192722 11:84098438-84098460 GACTCAGAGGAAACCTTCCCAGG + Intronic
1088977117 11:114825623-114825645 GACTCAGGGCCACCATTTGCTGG + Intergenic
1091398683 12:170001-170023 GACTCAGGGCCGACTGTGGCGGG - Intronic
1091508475 12:1097634-1097656 GACTCAAGGGGACCCTTGTCAGG + Intronic
1091550772 12:1533445-1533467 CACTTACGGGCAGCCTTGGCTGG + Intronic
1092061292 12:5552902-5552924 GACTCAGGGGGAAGGGTGGCAGG + Intronic
1096774092 12:53953898-53953920 GTCCCAGGGGCAGGCTTGGCCGG + Intergenic
1097536870 12:60883329-60883351 GACTCAGGGGAAAGGTTGGGAGG - Intergenic
1098001188 12:65945091-65945113 GCCTCAGGGGCATCCTGGGAGGG + Intronic
1098588340 12:72182484-72182506 GACTCAGGACCAAAATTGGCTGG + Intronic
1103036942 12:117664412-117664434 GCCCCAGGGGCCCCCTTGGCTGG + Intronic
1104901180 12:132190256-132190278 AAGTCAGGGGCAGCCTCGGCGGG - Intergenic
1104916370 12:132266912-132266934 GGCTCAGGGTCTCCCTTGGCTGG + Intronic
1105391299 13:19981240-19981262 GTCTCACTGGCAACCTAGGCTGG - Intronic
1114780965 14:25537687-25537709 GACTCCTGGGCTACATTGGCTGG - Intergenic
1117705706 14:58465138-58465160 TACCCAGGATCAACCTTGGCTGG - Intronic
1122459148 14:101880877-101880899 GAGTCCAGGGCAAACTTGGCTGG - Intronic
1122890983 14:104732142-104732164 GCCTCATGGTCAGCCTTGGCTGG + Intronic
1202905870 14_GL000194v1_random:72262-72284 AACTCAGGGGCCACCAGGGCTGG - Intergenic
1126379371 15:48030109-48030131 GCATCAGGAGCAACATTGGCTGG - Intergenic
1126840255 15:52710665-52710687 GAGTCAGGGGAAACCTTAGAAGG - Intergenic
1127316521 15:57799699-57799721 GACTCAGAAGCAAACTTAGCCGG + Intergenic
1128369519 15:67030166-67030188 GACAGAGGGGCACCCATGGCGGG - Intergenic
1132703659 16:1232066-1232088 GACTCAGGGGACACCAGGGCTGG + Intergenic
1132704850 16:1239295-1239317 GACTCAGGGGACACCAGGGCTGG - Intergenic
1132707859 16:1254329-1254351 GACTCAGGGGACACCAGGGCTGG - Intergenic
1139270018 16:65673187-65673209 GACTCAGGGGCAAACGATGCAGG - Intergenic
1141140679 16:81494889-81494911 AACTCACGGGCTTCCTTGGCAGG - Intronic
1141558750 16:84853197-84853219 GACACAAGGGGAAACTTGGCAGG + Intronic
1141561222 16:84868932-84868954 GACTCAGAGGCTACAGTGGCAGG - Intronic
1141600950 16:85126125-85126147 GCATCGGGGGCAACCCTGGCAGG + Intergenic
1144955287 17:19016007-19016029 GACTCAGGGGAAACGCTGGGAGG - Intronic
1148821997 17:50365184-50365206 GACTCAGAGGGAACCCAGGCTGG - Intergenic
1148837187 17:50471589-50471611 CACTCTGGGGCAACCTTTGAGGG - Intronic
1151202226 17:72476890-72476912 GACGGAGGCGCTACCTTGGCAGG + Intergenic
1151556239 17:74848098-74848120 GAGTCAGAGGCCCCCTTGGCTGG - Intronic
1152440812 17:80308422-80308444 GACTCAGGAGGAGCCTTGGGAGG - Intronic
1153451911 18:5238805-5238827 GAATCAGGGTCAAACTTGGAAGG + Intergenic
1155398686 18:25415268-25415290 GTCCCATGGGCAACCTTGGCTGG + Intergenic
1157804228 18:50646253-50646275 GCTTCAGGGACAGCCTTGGCTGG - Intronic
1159221971 18:65476717-65476739 GACTCAGGGGGTACCTATGCAGG - Intergenic
1159480686 18:68987480-68987502 TTCTCAGCGTCAACCTTGGCAGG + Intronic
1161720733 19:5900976-5900998 GACCCCGGGGCACCCTTGGAGGG + Intronic
1161851855 19:6741256-6741278 GACTCAGGATCATCCTTGGCAGG - Exonic
1163893544 19:20037952-20037974 CTCTCAGGGGCAACCCTGCCAGG - Intronic
1165271157 19:34708831-34708853 GACTCAGGGGAAAGGGTGGCAGG + Intergenic
1165363532 19:35350899-35350921 TTCTCAGGGGCCACCTGGGCAGG - Intergenic
1165365676 19:35363358-35363380 TTCTCAGGGGCCACCTGGGCAGG - Intergenic
925035257 2:680165-680187 GACCCAGAGGCAGCCTTGGGAGG + Intergenic
925123726 2:1438949-1438971 GACCCAGGGGCAGGCTTTGCAGG - Intronic
925907064 2:8545897-8545919 GCCTCAGGGACAACCCAGGCAGG - Intergenic
927194355 2:20537510-20537532 GCCACAGGGGCAAGGTTGGCGGG + Intergenic
928814394 2:35273699-35273721 AACTCAGGGTCAACCTTGCTGGG + Intergenic
934536824 2:95141032-95141054 GACTCAGGGGAAACGGTGGGAGG + Intronic
935753069 2:106256067-106256089 GACTCATGGGAAACCAAGGCGGG - Intergenic
935913491 2:107923600-107923622 GACTCATGGGAAACCAAGGCGGG - Intergenic
945286223 2:208085180-208085202 GACTCAGGGGCAAGTGTGGGAGG + Intergenic
947625214 2:231614498-231614520 GACTCGGGGGCAGCCGGGGCAGG - Intergenic
948342187 2:237262625-237262647 AACACAGGGGTAACCTTTGCAGG + Intergenic
949029838 2:241788609-241788631 CACCCAGGGGCACCTTTGGCTGG - Intronic
1168859700 20:1037110-1037132 GACTCATGGCCAGCATTGGCAGG + Intergenic
1171192201 20:23166640-23166662 GCCTCAGAGGCATCCTGGGCAGG + Intergenic
1174402153 20:50282003-50282025 GACTCCAGGGCATGCTTGGCGGG - Intergenic
1175306058 20:57976395-57976417 GACCCAGGGGCAGCCTGGGGTGG - Intergenic
1176154460 20:63611273-63611295 GAGGCAGAGGAAACCTTGGCAGG + Intronic
1176625230 21:9087019-9087041 AACTCAGGGGCCACCAGGGCTGG - Intergenic
1178552573 21:33553270-33553292 GACTCTGGGGCAGCCATGGCTGG - Exonic
1180045159 21:45301795-45301817 CACTCAGGGGCAGGCTCGGCAGG + Intergenic
1180309783 22:11159294-11159316 GGCTCAGGTGCTACCTTTGCCGG + Intergenic
1180548260 22:16521104-16521126 GGCTCAGGTGCTACCTTTGCCGG + Intergenic
1182803033 22:33047436-33047458 TACTCAGGGGCCACGTAGGCAGG - Intronic
1183369353 22:37423767-37423789 GACTCAAGAGCCACCTGGGCAGG - Intronic
1183875784 22:40779781-40779803 TACTCTGAGGCAACCTTGGGGGG - Intronic
1185260519 22:49859419-49859441 GACACAGGGGCCAGCTTGGAAGG - Intronic
950542356 3:13620116-13620138 GACTCAGGTGCACACTCGGCAGG - Intronic
953550457 3:43898527-43898549 CACTCAGGGTCAGACTTGGCTGG - Intergenic
953682579 3:45051013-45051035 GACTCAGAGGGAGCCATGGCTGG + Intergenic
954439755 3:50515455-50515477 AACTGAGGGGCAAGCTGGGCCGG - Intergenic
954638443 3:52084318-52084340 CACTCATGGGCAAACATGGCAGG + Intronic
960989519 3:123301578-123301600 GAATCAGGAGCAACCTTTGAGGG + Intronic
960995601 3:123338265-123338287 GCCTCAGCAGCAACCTTGCCTGG - Intronic
968910574 4:3475328-3475350 GCCTCAGGCGCATCCTTGTCAGG - Intronic
973339075 4:48986093-48986115 GCCCCAGCGGCACCCTTGGCCGG - Intergenic
979597521 4:122550700-122550722 GACTCAGGGGGTACATGGGCAGG - Intergenic
983368399 4:166825882-166825904 GACTCAGGGGGAAGGTTGGAAGG + Intronic
984702355 4:182826420-182826442 GTCCCAGGGGCAACCCTGCCAGG + Intergenic
987292135 5:16519376-16519398 GAGTCAGGGGCAATCTTTGCAGG - Intronic
987302672 5:16610271-16610293 CACGCAGGGGCACCCCTGGCGGG - Intronic
988499236 5:31770475-31770497 GACTCAGGGGTGACCTGGGATGG - Intronic
991488814 5:67164493-67164515 GACTCAGGAGCAACCAAGCCAGG - Exonic
995106398 5:108381558-108381580 GGCTGAGGGGGCACCTTGGCTGG + Exonic
995988910 5:118211775-118211797 GACACTGGGGAAATCTTGGCAGG + Intergenic
997611320 5:135217786-135217808 GCCCCAGGTGCAACCCTGGCTGG - Intronic
999721081 5:154399785-154399807 GACTCAGGGCCAGTGTTGGCAGG - Intronic
1000431042 5:161152736-161152758 GACTCTGGGGCTGTCTTGGCTGG - Intergenic
1001108545 5:168876156-168876178 GACTCAGGGGCTAGCTGGGTGGG - Intronic
1001920637 5:175596772-175596794 AACTCAGGGGCAGCCTAGCCGGG + Intergenic
1002772363 6:300871-300893 GACTCAGGGGCAACCTTGGCAGG + Intronic
1004811596 6:19269466-19269488 GCCTCATGGGCCACCTTTGCTGG + Intergenic
1005506381 6:26472462-26472484 GACTTAGCTGAAACCTTGGCTGG - Intronic
1005523402 6:26621333-26621355 GACTAATTGGGAACCTTGGCGGG + Intergenic
1007709405 6:43812232-43812254 CAGTCAGGGTCAAGCTTGGCAGG + Intergenic
1024242379 7:47445503-47445525 GATTCAGGGGCAGCCTGTGCAGG - Intronic
1026598161 7:71751848-71751870 GACTCAGGGGCAGCATGTGCAGG + Intergenic
1029599036 7:101553219-101553241 GAGTCAGGGGCAGGCTGGGCAGG - Intronic
1035463517 7:159061312-159061334 GACTCAGGGGGCACATGGGCAGG - Intronic
1042294759 8:67206744-67206766 TTCTCAGGGGCAGCTTTGGCAGG + Intronic
1042745700 8:72103313-72103335 GAGTCAGGGCAAACCTTGACTGG + Intronic
1042979147 8:74506193-74506215 GACTAAGGGGCTAGGTTGGCTGG - Intergenic
1048469845 8:134696265-134696287 GACTCAGGGGCTGCCTTGGTTGG - Intronic
1049353639 8:142177305-142177327 GGCCCAGGGGCAGCCTTGGAGGG - Intergenic
1049697905 8:143992611-143992633 GAGTGAGGGGTGACCTTGGCCGG + Intronic
1049755681 8:144310347-144310369 GGCTCTGGGGAAACCTTAGCAGG + Intronic
1053239793 9:36486951-36486973 GACCCAGGGCCACCCTGGGCCGG - Intronic
1060198366 9:121637598-121637620 TACTCAGGGGCTAACTGGGCAGG - Intronic
1061251506 9:129428970-129428992 GATTCAGGGCCCACCTTTGCAGG + Intergenic
1061793105 9:133068876-133068898 GACTCAGGGGCGACCCGTGCGGG + Intronic
1061795708 9:133084660-133084682 GACTCAGGGGCGACCCGTGCGGG + Intronic
1062375655 9:136260725-136260747 TGCTCAGGGGCACCCTTGGGTGG - Intergenic
1062416731 9:136454971-136454993 GGCTCAGGGCCAAGCTTGGAGGG + Intronic
1203748404 Un_GL000218v1:57479-57501 AACTCAGGGGCCACCAGGGCTGG - Intergenic
1187426572 X:19182739-19182761 GAATCAGGGGACAGCTTGGCTGG + Intergenic
1190569892 X:51770333-51770355 CACCCAGGGGCACCTTTGGCTGG - Intergenic
1195709081 X:107759869-107759891 GCCTCAGGGCCAGCCTGGGCTGG + Intronic
1197074039 X:122334323-122334345 GATTCAGGGGCTAGCTTTGCAGG - Intergenic
1197392842 X:125889757-125889779 GACTCAGGGGAAAGGGTGGCAGG - Intergenic
1198103564 X:133441773-133441795 TCCTCAGGGGCAGCCATGGCTGG - Intergenic
1198226860 X:134653227-134653249 GGCTCAGGGGCCATGTTGGCAGG + Intronic
1201161750 Y:11172449-11172471 AACTCAGGGGCCACCAGGGCTGG - Intergenic