ID: 1002772898

View in Genome Browser
Species Human (GRCh38)
Location 6:304415-304437
Sequence GACTCGCTGGGTTTAGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002772898_1002772916 24 Left 1002772898 6:304415-304437 CCGGGCCCTAAACCCAGCGAGTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1002772916 6:304462-304484 CACAGGCCGCTGGGGATGTTGGG 0: 1
1: 0
2: 2
3: 13
4: 147
1002772898_1002772912 16 Left 1002772898 6:304415-304437 CCGGGCCCTAAACCCAGCGAGTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1002772912 6:304454-304476 CGGCCTTCCACAGGCCGCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 150
1002772898_1002772905 -4 Left 1002772898 6:304415-304437 CCGGGCCCTAAACCCAGCGAGTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1002772905 6:304434-304456 AGTCGATGGGCACCAACCCACGG 0: 1
1: 0
2: 0
3: 1
4: 50
1002772898_1002772911 15 Left 1002772898 6:304415-304437 CCGGGCCCTAAACCCAGCGAGTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1002772911 6:304453-304475 ACGGCCTTCCACAGGCCGCTGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1002772898_1002772910 14 Left 1002772898 6:304415-304437 CCGGGCCCTAAACCCAGCGAGTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1002772910 6:304452-304474 CACGGCCTTCCACAGGCCGCTGG 0: 1
1: 0
2: 1
3: 12
4: 107
1002772898_1002772915 23 Left 1002772898 6:304415-304437 CCGGGCCCTAAACCCAGCGAGTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1002772915 6:304461-304483 CCACAGGCCGCTGGGGATGTTGG 0: 1
1: 0
2: 2
3: 24
4: 263
1002772898_1002772906 7 Left 1002772898 6:304415-304437 CCGGGCCCTAAACCCAGCGAGTC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1002772906 6:304445-304467 ACCAACCCACGGCCTTCCACAGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002772898 Original CRISPR GACTCGCTGGGTTTAGGGCC CGG (reversed) Intronic