ID: 1002775951

View in Genome Browser
Species Human (GRCh38)
Location 6:327612-327634
Sequence GGCGCATGGCCCTGGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 285}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002775951_1002775958 -1 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775958 6:327634-327656 CTGTGTGCTGCTGGTGGTGTGGG No data
1002775951_1002775963 13 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775963 6:327648-327670 TGGTGTGGGGGCCCAGCGTGGGG No data
1002775951_1002775953 -10 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775953 6:327625-327647 GCCATGCGCCTGTGTGCTGCTGG 0: 1
1: 0
2: 1
3: 5
4: 126
1002775951_1002775966 29 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775966 6:327664-327686 CGTGGGGCTGAAGTCTGCTAAGG 0: 1
1: 0
2: 1
3: 11
4: 129
1002775951_1002775961 11 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775961 6:327646-327668 GGTGGTGTGGGGGCCCAGCGTGG No data
1002775951_1002775955 -7 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775955 6:327628-327650 ATGCGCCTGTGTGCTGCTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 187
1002775951_1002775959 0 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775959 6:327635-327657 TGTGTGCTGCTGGTGGTGTGGGG 0: 1
1: 0
2: 10
3: 81
4: 762
1002775951_1002775962 12 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775962 6:327647-327669 GTGGTGTGGGGGCCCAGCGTGGG No data
1002775951_1002775957 -2 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775957 6:327633-327655 CCTGTGTGCTGCTGGTGGTGTGG 0: 1
1: 0
2: 5
3: 53
4: 541
1002775951_1002775967 30 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775967 6:327665-327687 GTGGGGCTGAAGTCTGCTAAGGG 0: 1
1: 0
2: 3
3: 11
4: 172
1002775951_1002775960 1 Left 1002775951 6:327612-327634 CCTCTGTGCCAGGGCCATGCGCC 0: 1
1: 0
2: 4
3: 16
4: 285
Right 1002775960 6:327636-327658 GTGTGCTGCTGGTGGTGTGGGGG 0: 1
1: 1
2: 4
3: 69
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002775951 Original CRISPR GGCGCATGGCCCTGGCACAG AGG (reversed) Intronic
900137090 1:1122241-1122263 GGCTCAGGGACCTGGCACTGGGG - Intergenic
900572743 1:3366978-3367000 GGAGCAAGGGCCGGGCACAGTGG + Intronic
900591350 1:3461643-3461665 GGCGCATTGCTCGGCCACAGCGG - Intronic
902696772 1:18145513-18145535 GGCACTGGGCCCTGGGACAGAGG + Intronic
902843238 1:19088789-19088811 AGCGCATGGCCATGGCAATGAGG - Exonic
903493596 1:23748616-23748638 TACCCATGGACCTGGCACAGAGG - Intronic
903953442 1:27009792-27009814 GCCCCATGGCCCTGACGCAGGGG - Intronic
904109737 1:28116441-28116463 GGCCCTTGGGCCGGGCACAGTGG - Intergenic
904379456 1:30101259-30101281 GGGGCATGGCTCCGGGACAGGGG + Intergenic
904714424 1:32456641-32456663 GGCGGATGACCCTGGTGCAGCGG + Intergenic
904996003 1:34631858-34631880 GGCACATGGCTCTGGGCCAGTGG + Intergenic
906104348 1:43283045-43283067 GGCCCCTGGCCCAGGCACTGGGG - Exonic
907802194 1:57780396-57780418 GTAGCATGGCCCTGTCAGAGAGG + Intronic
908851022 1:68375796-68375818 GGGCAATGGCCCTGGAACAGGGG - Intergenic
910909011 1:92214390-92214412 GGCCAATGGGCCTGGAACAGAGG + Intergenic
912431931 1:109632614-109632636 GGAGCACCTCCCTGGCACAGAGG + Intergenic
913072049 1:115308234-115308256 GGGGCATGGCAGTGGCACAGAGG - Intronic
916009179 1:160689186-160689208 GGTGCATGTCCGAGGCACAGAGG + Intronic
918086795 1:181252410-181252432 GGTGCATGTCCAAGGCACAGAGG - Intergenic
918731544 1:188003310-188003332 GGCACATAGGCCAGGCACAGTGG - Intergenic
919008420 1:191929043-191929065 GGAGCAACGGCCTGGCACAGGGG - Intergenic
919864800 1:201772744-201772766 GGAGCTTGGGCCGGGCACAGTGG + Intronic
919958115 1:202438978-202439000 AGCGCATGGCCCTGGCCAACCGG + Intronic
920020919 1:202956061-202956083 GGGGCATAGGCCGGGCACAGTGG - Intronic
920398905 1:205664989-205665011 GGCGACTGGCCCTGTCACCGAGG + Intronic
920509259 1:206538610-206538632 GCCTCATAGCCCTGGGACAGTGG + Intronic
921684644 1:218075919-218075941 GGAGCAAGGCCTTGGAACAGGGG - Intergenic
922242029 1:223761781-223761803 GGCCCATGCCCCCAGCACAGAGG - Intronic
922425347 1:225487050-225487072 GGGGCCTGGCCCTGTCACTGTGG - Exonic
922854275 1:228760782-228760804 AGGGCATGGGCCTGGCACGGTGG + Intergenic
923684882 1:236147094-236147116 GGAGTATGGGCCAGGCACAGTGG - Intronic
924690904 1:246349315-246349337 GGAGCAGGGGCCGGGCACAGTGG + Intronic
1062858010 10:789188-789210 GGCGCATGGGCCTTGCAAAGGGG - Intergenic
1063573003 10:7233841-7233863 GTCCCATGGCCCTGGCAGGGAGG + Intronic
1063586639 10:7358502-7358524 CCTGCATGGCCCTGGAACAGAGG + Intronic
1064421536 10:15195040-15195062 GGTGCATGGACCAGGCACAGCGG - Intergenic
1064662233 10:17617472-17617494 AACGCCTGGCCCTGGCACTGGGG + Intergenic
1064858292 10:19796363-19796385 GCCTCATGGACCAGGCACAGTGG - Intergenic
1067097509 10:43312166-43312188 TGGGCATGGGCCTGGCGCAGTGG + Intergenic
1067346216 10:45440833-45440855 GGGGCATGGGCCTGACACACGGG + Intronic
1067384558 10:45806521-45806543 GGTGAATGGGCCAGGCACAGTGG + Intergenic
1070083367 10:73210534-73210556 TGCGTATGGGCCAGGCACAGTGG + Intronic
1070129698 10:73647845-73647867 GGCGCCTGCCCCAGGCCCAGGGG - Exonic
1071456032 10:85852354-85852376 GGCGCATTGCCTTGGCAACGTGG + Intronic
1072385887 10:94927853-94927875 GGCTTATGGGCCGGGCACAGTGG - Intergenic
1072615950 10:97049006-97049028 GGCGCCGGGGACTGGCACAGCGG + Exonic
1072742858 10:97920638-97920660 GGCTAATGGCCCTGGACCAGTGG - Intronic
1072807133 10:98430648-98430670 GGCGCAGGGAGCTGGCACTGTGG + Exonic
1072919285 10:99562240-99562262 GAACCATGGGCCTGGCACAGTGG - Intergenic
1073354222 10:102840996-102841018 GGTGCATGTCCGAGGCACAGAGG + Intergenic
1073586653 10:104717000-104717022 GCAGCATGGGCCAGGCACAGTGG + Intronic
1074211326 10:111338091-111338113 GGTGAATGAACCTGGCACAGAGG + Intergenic
1074455165 10:113589949-113589971 GCAGCATCTCCCTGGCACAGGGG + Intronic
1074535024 10:114322702-114322724 GGCTCCTGTCCCTGACACAGCGG + Intronic
1076756589 10:132575776-132575798 GGCCCAGGGCCCTGGCAGTGGGG + Intronic
1076980081 11:199544-199566 GGGGCAGGGTCCTGGCCCAGAGG + Intronic
1077114046 11:875112-875134 GGGGCCTGGGCCTGGCACTGGGG - Intronic
1084194249 11:67515200-67515222 GGGGCAGGGGCCGGGCACAGTGG - Intergenic
1084223971 11:67703507-67703529 GGTGCATGTCCGAGGCACAGAGG - Intergenic
1084667258 11:70583089-70583111 GGTGCCTGGCCCTGGGGCAGGGG + Intronic
1085792818 11:79510733-79510755 GGCACAAGGCCCTGCCCCAGTGG + Intergenic
1086879718 11:92139009-92139031 GGAACATGGGCCAGGCACAGTGG + Intergenic
1086993530 11:93330922-93330944 GGCGCGTGGCGCGGGGACAGAGG + Intronic
1087680502 11:101214109-101214131 GGTGCATGTCCAAGGCACAGAGG + Intergenic
1089150044 11:116357351-116357373 GGAGCAGGGCCCTTGCAGAGTGG - Intergenic
1089796355 11:120984479-120984501 GGCCCATCGGCCAGGCACAGTGG + Intronic
1090036401 11:123253238-123253260 AGCACATGGGCCGGGCACAGTGG - Intergenic
1091369396 11:135046128-135046150 GGGGCAGGGCCATGGCACAGAGG + Intergenic
1092241528 12:6839088-6839110 GGCGCTGTGCCCTGGCACTGTGG + Exonic
1094423937 12:30299745-30299767 GGGGCATGGCCCTGGCAGCCTGG + Intergenic
1094847028 12:34365823-34365845 GGCGCATGGGCTGGGCCCAGTGG - Intergenic
1096494100 12:52029357-52029379 AGCCCATGGCCAAGGCACAGGGG + Intronic
1099201187 12:79679048-79679070 GGGCCATGGGCCGGGCACAGTGG - Intronic
1100390337 12:94141543-94141565 GGGCCATGGCCCGGGCTCAGGGG + Intergenic
1100927888 12:99570358-99570380 GGCGGATAGGCCGGGCACAGTGG + Intronic
1101930474 12:109009704-109009726 GGCGCCTGGCCCTAGAGCAGTGG + Intronic
1102030966 12:109739893-109739915 GGCGCATGGGCTTGGTACAGAGG + Intronic
1102653513 12:114460882-114460904 GGAGAATGGCCCCTGCACAGTGG + Intergenic
1102690731 12:114758609-114758631 GGAGCATGGGCCAGGCACGGTGG - Intergenic
1103398027 12:120622947-120622969 GGGGCAGGGACCAGGCACAGTGG - Intergenic
1105064955 12:133188482-133188504 GGGCCATGGGCCAGGCACAGTGG - Intronic
1106317985 13:28612081-28612103 GACACATGGCCCTGCCACTGAGG - Intergenic
1107466720 13:40657619-40657641 GGAGATTGGGCCTGGCACAGTGG - Intronic
1110591095 13:77260125-77260147 GGGACATGTCCCTGGGACAGTGG - Intronic
1113711299 13:112466971-112466993 GCCGCATTCCTCTGGCACAGGGG - Intergenic
1113765723 13:112880145-112880167 GTCGCAGGGCCCTGGTAGAGCGG + Intronic
1113896598 13:113768516-113768538 GGCACCTGGGCCAGGCACAGAGG - Intronic
1114539321 14:23443113-23443135 GGCTCAAGGCCCAGGGACAGTGG + Intergenic
1117020995 14:51570100-51570122 GGCTCATGGGCCGGGCGCAGTGG - Intronic
1117766920 14:59093032-59093054 GTCACCTGGCCCTGGCCCAGTGG - Intergenic
1119376040 14:74194131-74194153 GGTGCAGAGCCCTGGCAGAGAGG + Intronic
1119927317 14:78507434-78507456 GTGGCATGGCCCTGGCCCCGGGG - Intronic
1120639765 14:86996565-86996587 TGAGCATGGGCCGGGCACAGTGG + Intergenic
1120808423 14:88777687-88777709 GGAGGATGGGCCGGGCACAGTGG + Intronic
1121239922 14:92421792-92421814 GGTGTATGGGCCTGGCACAGTGG - Intronic
1122400554 14:101464909-101464931 GGAGCAGGTCCCTGGCTCAGCGG - Intergenic
1122917665 14:104866220-104866242 GTGGCCTGGCTCTGGCACAGCGG + Intronic
1127590402 15:60416464-60416486 GGCCCTTGGCCCTAGCAAAGGGG + Intergenic
1128455871 15:67831052-67831074 GACACATTACCCTGGCACAGAGG + Intronic
1128728343 15:70004405-70004427 GGAGCAGGGGCCAGGCACAGAGG - Intergenic
1129267278 15:74400503-74400525 GGAGCTTGGGCCGGGCACAGTGG + Intergenic
1129596402 15:76967641-76967663 GGCCCATGGACTTGCCACAGAGG + Intergenic
1130792624 15:87171947-87171969 GGCCCATGTCCCTGACAAAGGGG - Intergenic
1131273230 15:90959575-90959597 TGCACCTGGCCCTGGCCCAGTGG + Intronic
1132147396 15:99436899-99436921 GGGACATGGCCCTGGCCCATGGG - Intergenic
1132685273 16:1159471-1159493 GGCGCGTGGCGGTGGCACACCGG + Intronic
1132937237 16:2487279-2487301 GCCGCCTCTCCCTGGCACAGAGG + Intronic
1137719288 16:50618547-50618569 GGCGCCTGCCCCTGGCATTGGGG + Intronic
1138281296 16:55773817-55773839 GGCACCAGGCCCTGGCACATAGG - Intergenic
1138287243 16:55820044-55820066 GGCACCAGGCCCTGGCACATAGG + Intronic
1138767776 16:59624576-59624598 GGTGCATGTCCGAGGCACAGAGG + Intergenic
1139088405 16:63616576-63616598 GGCTCCAGGCACTGGCACAGTGG + Intergenic
1139192430 16:64880133-64880155 CTAGCATGGCCCAGGCACAGTGG - Intergenic
1139501883 16:67373418-67373440 CGGGCATGGACCGGGCACAGTGG + Intronic
1141474887 16:84266190-84266212 GGCACATGGTCCTGGCATGGAGG + Intergenic
1141648102 16:85378119-85378141 GGGGCAGGGCCCTGGGCCAGTGG + Intergenic
1141897704 16:86969124-86969146 GGCGCCTGGCCCTGGAGCACAGG + Intergenic
1142032339 16:87844769-87844791 GGCGGAAGGCCCCAGCACAGTGG - Intronic
1203122912 16_KI270728v1_random:1554938-1554960 GGCGCACGGCGCTGGCGCCGAGG - Intergenic
1142654956 17:1385563-1385585 GGTGCATGGCCTGGGCACTGGGG + Intronic
1142801527 17:2349086-2349108 GGAGCATAGGCCGGGCACAGTGG + Intronic
1142851733 17:2707783-2707805 GGCCCTTGGCCCAGGGACAGTGG - Intronic
1142958049 17:3534757-3534779 TGCACTGGGCCCTGGCACAGAGG + Intronic
1143416886 17:6756852-6756874 TGCCCATGTTCCTGGCACAGGGG - Intronic
1143851743 17:9817994-9818016 GCCTTATGGGCCTGGCACAGTGG + Intronic
1143985479 17:10909698-10909720 GGTGCCTGGCCCAGGCACGGTGG - Intergenic
1147551986 17:41449710-41449732 AGAGCATCGGCCTGGCACAGTGG + Intergenic
1148816346 17:50330699-50330721 AGTGCTTGGCCCAGGCACAGTGG + Intergenic
1148859987 17:50599786-50599808 GGCGCCTGGCCCGGGCCCTGCGG + Exonic
1149776052 17:59358125-59358147 GGTGGATGGCCCTGGCTCTGAGG - Intronic
1150073479 17:62172442-62172464 GGCTAATGGGCCCGGCACAGTGG + Intergenic
1150333649 17:64314258-64314280 TGCAAATGGCCCTGCCACAGGGG + Intergenic
1151318363 17:73337713-73337735 GGCGACTGGCCTTGGCACTGTGG - Exonic
1151613494 17:75192584-75192606 CGGGCATGGGCCTGGCGCAGTGG - Intergenic
1151826040 17:76524999-76525021 GTCTCCTGGGCCTGGCACAGGGG - Intergenic
1152063676 17:78098002-78098024 GGGGCCTTGCCCAGGCACAGTGG + Intronic
1152566403 17:81102288-81102310 GCGGCACGGCCCTGACACAGCGG - Intronic
1152827302 17:82475274-82475296 GGCCCATGCCCCTGGAGCAGTGG + Intronic
1153554616 18:6298579-6298601 TGCGCCTGGCCCTGGCAGTGAGG - Intronic
1156342905 18:36227681-36227703 TGGGCATGGGCCAGGCACAGTGG - Intronic
1157885841 18:51365532-51365554 TGCTCCTGGCCCAGGCACAGTGG - Intergenic
1158191246 18:54831327-54831349 AGCCCATGAACCTGGCACAGAGG + Intronic
1159027928 18:63203124-63203146 GGGGCTTGGTCCTGGCAAAGTGG - Intronic
1159713831 18:71797322-71797344 TGCTCATGGCCCTGGCACCCTGG - Intergenic
1160169008 18:76537612-76537634 GGCGCAGAGGCCGGGCACAGTGG - Intergenic
1160669064 19:348095-348117 TGCCCCTGGCCGTGGCACAGTGG + Intergenic
1161054427 19:2182917-2182939 GGAGCAGGGTCCAGGCACAGGGG + Intronic
1161198453 19:3000603-3000625 GGCACATGGCCCTGCCAGAGTGG + Intronic
1162353688 19:10167093-10167115 GCGGCAGGGCCCTGGCAGAGTGG - Intronic
1162360061 19:10214200-10214222 GGTGCAAGGGCCAGGCACAGTGG + Intronic
1163649147 19:18506992-18507014 GGCACATGGCCCTCGACCAGTGG + Intronic
1164330229 19:24247390-24247412 GGTGCATGTCCGAGGCACAGAGG - Intergenic
1164485911 19:28655381-28655403 GGGGGATGTGCCTGGCACAGTGG - Intergenic
1164809944 19:31147885-31147907 GGCACATGGCCAGGGCTCAGTGG + Intergenic
1164840482 19:31389176-31389198 GGAGCATGGACCTTGCACACAGG - Intergenic
1165277732 19:34769481-34769503 GGCACCTGGACCTGGCCCAGAGG - Exonic
1165765087 19:38345478-38345500 TGGGCATGGGCCGGGCACAGTGG - Intronic
1165941660 19:39417572-39417594 GGCGGAGGGCCCAGGCACTGGGG + Exonic
1166012852 19:39956235-39956257 GGCTCATGGGCCAGGCACAGTGG - Intergenic
1166664971 19:44673956-44673978 GGGGCTTGGGCCTGGCACGGTGG + Intronic
1167587798 19:50384604-50384626 GGCGCATGCGCCGGGCACCGTGG + Intronic
1168257748 19:55175876-55175898 GCTGCAGGGCCCAGGCACAGTGG + Exonic
925945392 2:8857804-8857826 GGCGCAGAGCCCTGGCATGGGGG + Exonic
926414292 2:12633849-12633871 GGGGCCTGGACCTGGGACAGTGG + Intergenic
926654643 2:15387920-15387942 GGTGAATGGGCCAGGCACAGTGG - Intronic
931600112 2:63994560-63994582 GGTGCATGTCCGAGGCACAGAGG - Intronic
933876375 2:86624507-86624529 TGTACATGGGCCTGGCACAGTGG + Intronic
934556605 2:95289881-95289903 GGCCCAAGGCCCTGGGGCAGTGG - Exonic
935142351 2:100364511-100364533 GGTGCATGTCCGAGGCACAGAGG + Intergenic
937443935 2:121940825-121940847 TGCGCTTGGGCCGGGCACAGTGG - Intergenic
938716633 2:134027736-134027758 GGCCCACCGCCCTGGCCCAGAGG - Intergenic
939511365 2:143109837-143109859 GGCACATGTCCCTGGCCCTGAGG + Intronic
940636006 2:156297688-156297710 AGAACATGGCCCTGGCACAGTGG - Intergenic
942222928 2:173789071-173789093 GGTGCCTGGGCCAGGCACAGTGG - Intergenic
942268142 2:174248356-174248378 GGCGCGGGGCCCGGGCCCAGTGG - Intronic
946013714 2:216587286-216587308 AGTGCATGGGCCAGGCACAGTGG - Intergenic
946889665 2:224262079-224262101 GTGGGATGGGCCTGGCACAGTGG - Intergenic
947216896 2:227758115-227758137 GGTGCCTGGCCCAGGCCCAGGGG + Intergenic
947767465 2:232646872-232646894 GGCCCAAGGCCATGGCAGAGTGG + Intronic
948024132 2:234763496-234763518 GTTGCATGGCCATAGCACAGAGG + Intergenic
948041923 2:234908958-234908980 TGTGCCTGGCCCTGGTACAGTGG - Intergenic
948616761 2:239204291-239204313 GGCCCGTGGCCCGGGCACAGGGG - Intronic
1169193207 20:3670484-3670506 AAGGCAGGGCCCTGGCACAGGGG + Intronic
1170177132 20:13484445-13484467 GGCACATAGGCCGGGCACAGTGG + Intronic
1170208589 20:13825368-13825390 GGATGATGGGCCTGGCACAGTGG + Intergenic
1170268458 20:14497020-14497042 GGCTCCTTGCCCTGGCACTGTGG + Intronic
1170647098 20:18207332-18207354 GGGGTATAGCCCTGGCATAGGGG + Intergenic
1171445037 20:25196752-25196774 CGCCCATGGCTCTTGCACAGCGG - Intronic
1172441863 20:34971593-34971615 GGCCCACGACCCTGGCACACTGG - Intergenic
1172628877 20:36365190-36365212 GCCGCAGGGCCCTGGCCTAGGGG - Intronic
1174799532 20:53551623-53551645 GGCGCATGGGCTGGGCGCAGTGG - Intergenic
1174932305 20:54829283-54829305 GAGGCATGGCCCTGACCCAGTGG + Intergenic
1175969262 20:62675650-62675672 GGCTCCTGGCCCTGCCACAGAGG + Intronic
1176301873 21:5102402-5102424 CCCCCATGGCCCAGGCACAGAGG - Intergenic
1176301893 21:5102468-5102490 CCCCTATGGCCCTGGCACAGAGG - Intergenic
1176671939 21:9743643-9743665 GGCGCATGGCCCTGGCATCGTGG + Intergenic
1179855137 21:44159432-44159454 CCCCTATGGCCCTGGCACAGAGG + Intergenic
1179855158 21:44159498-44159520 CCCCCATGGCCCAGGCACAGAGG + Intergenic
1180099259 21:45576791-45576813 GGCCCCTGGCCCTGCCCCAGGGG - Intergenic
1180917369 22:19498642-19498664 GGCACATGCCCCCAGCACAGGGG - Intronic
1180991450 22:19939680-19939702 GGTGCATGTCCAAGGCACAGAGG - Intronic
1181741846 22:24927484-24927506 GGAGCATGGGCCAGGCACAGTGG + Intronic
1181851768 22:25754747-25754769 GGCTCCTGGCCCTGGGTCAGTGG + Intronic
1182564363 22:31186312-31186334 GGCGTATGGGCTGGGCACAGTGG + Intronic
1184789127 22:46688529-46688551 GGCGCGTGGCCCTGGGCCTGGGG + Intronic
1185174965 22:49321250-49321272 AGAGCATGGCACTGGGACAGAGG - Intergenic
1185272118 22:49934553-49934575 GGTGGAGGGCCCTGGCCCAGTGG + Intergenic
950664150 3:14484794-14484816 GGCAGATGGCCCTGGCGAAGGGG + Intronic
953476859 3:43212542-43212564 AGAGCTGGGCCCTGGCACAGTGG + Intergenic
953866145 3:46585000-46585022 GGCGCATGGCCTTGGGTAAGTGG + Intronic
953929379 3:46998384-46998406 GGCACATGGCCCTGGCCTGGAGG + Intronic
954447218 3:50553241-50553263 TGCCGATGGCTCTGGCACAGGGG + Intergenic
954670037 3:52285873-52285895 TGGGCATGGGCCGGGCACAGTGG - Intronic
955022140 3:55131820-55131842 CACGCATGGCCCTGTCACAAGGG - Intergenic
956183686 3:66542628-66542650 GGCTCATAGGCCGGGCACAGTGG - Intergenic
959478933 3:106847543-106847565 GCAGCATGGGCCGGGCACAGTGG + Intergenic
959888370 3:111527661-111527683 GGTGCATGTCCGAGGCACAGAGG - Intronic
960571644 3:119190630-119190652 GGCCCATGGCCATGGCAGAGTGG - Intronic
961922852 3:130446121-130446143 GGTGCATGTCCGAGGCACAGAGG + Intronic
965679399 3:171234872-171234894 GGCGCAAGGCCCTGGCCCAGAGG - Intronic
965882860 3:173408623-173408645 GGCGCATTGGCCGGGCGCAGTGG + Intronic
966456521 3:180122465-180122487 GGCACATTGGCCAGGCACAGTGG - Intergenic
966660773 3:182412078-182412100 GGAGCTTGGCCCTAACACAGGGG - Intergenic
968239183 3:197060419-197060441 GGAACCTGGGCCTGGCACAGTGG - Intronic
968910562 4:3475262-3475284 GGCGCAGGGCCATGGCACAGAGG + Intronic
969346238 4:6571961-6571983 CGCCCATGGGCCAGGCACAGTGG + Intergenic
969602193 4:8183007-8183029 GGCGCAGGGGCCTGACCCAGAGG + Intronic
972272249 4:37522779-37522801 GGAGCAAGGACCTGGAACAGGGG + Intronic
975402009 4:73949519-73949541 GGTGCATGTCCAAGGCACAGAGG + Intergenic
975955059 4:79827019-79827041 GGTGCATGTCCAAGGCACAGAGG + Intergenic
977441325 4:97071442-97071464 GGCACGTGGGCCAGGCACAGTGG + Intergenic
977561495 4:98537731-98537753 GTGGCAAGGGCCTGGCACAGAGG + Intronic
982795400 4:159638101-159638123 GGCTCACAGGCCTGGCACAGTGG + Intergenic
985402796 4:189608179-189608201 GGCGCATGGCCCTGGCATCGTGG - Intergenic
985629871 5:1008830-1008852 GGCGCAGGGCGCGGGGACAGCGG - Exonic
987800355 5:22687700-22687722 GGAGCATGAGCCAGGCACAGTGG - Intronic
988561412 5:32285068-32285090 GAAGCATGGGCCAGGCACAGTGG + Intronic
988706259 5:33728560-33728582 GGCAAATGGCCTTGGCAGAGAGG - Intronic
989199265 5:38747391-38747413 GGCCCATGGGCCTGTCCCAGAGG - Intergenic
990241383 5:53819783-53819805 GGGGCTTGGCCGTGGCACTGAGG - Intergenic
994274938 5:97823839-97823861 GTAGCATGGGCCAGGCACAGTGG - Intergenic
998458542 5:142292518-142292540 GTCACATGGGCCAGGCACAGTGG + Intergenic
998859497 5:146428660-146428682 GGCAAATGGCCCTGGCCCACTGG - Intergenic
1001797265 5:174513068-174513090 GGGGCATGGCCCAGGCAAGGGGG - Intergenic
1002775951 6:327612-327634 GGCGCATGGCCCTGGCACAGAGG - Intronic
1003887475 6:10534421-10534443 GCAGCATGGGCCAGGCACAGTGG - Intronic
1004750092 6:18553786-18553808 GGAGCATGGTCCTGGCACGGTGG + Intergenic
1005942489 6:30571320-30571342 GGGGCGTGGCCCTGGTTCAGTGG - Intergenic
1006456175 6:34133307-34133329 GGTGCATGGCCGGGGCTCAGAGG - Exonic
1007345018 6:41222827-41222849 AGCGCCAGGCCCTGGGACAGGGG + Intergenic
1007395993 6:41578120-41578142 GGAGTGTGGGCCTGGCACAGAGG + Intronic
1013670683 6:112399415-112399437 TGAGCAAGGCCCTGGCAGAGGGG - Intergenic
1018688725 6:166325658-166325680 GGTGAAGGGCCCTGGCTCAGGGG - Intronic
1019406578 7:887186-887208 GGCACATGGCGCTGGAACTGCGG + Intronic
1019639891 7:2097679-2097701 AGGGCACGCCCCTGGCACAGGGG + Intronic
1019650863 7:2157532-2157554 GGCCCAGGGCCCTGGGACACAGG + Intronic
1019802198 7:3096265-3096287 GACGCATCGCCCTCTCACAGGGG - Intergenic
1022391271 7:29946711-29946733 GACCCATGGTCCTGGCACAAGGG - Intronic
1023817650 7:43962635-43962657 GGCCCCTGGGCCTGGCGCAGTGG + Intergenic
1024294819 7:47833529-47833551 GAGGCATGACCCTGCCACAGAGG + Intronic
1024553259 7:50581377-50581399 GGTGCATGTCCGAGGCACAGAGG - Intergenic
1025119402 7:56287825-56287847 CGCGCTTGGCGCTGACACAGCGG + Intergenic
1026014800 7:66664664-66664686 GGCCCAAAGCCCTGGCTCAGGGG - Intronic
1026891188 7:73983774-73983796 GGCCCAAGGCCCTGCCTCAGGGG - Intergenic
1029742275 7:102497509-102497531 GGCCCCTGGGCCTGGCGCAGTGG + Intronic
1029760265 7:102596674-102596696 GGCCCCTGGGCCTGGCGCAGTGG + Intronic
1030723977 7:112903024-112903046 GCCGCATAGGCCAGGCACAGTGG + Intronic
1032632649 7:133670535-133670557 GGCTCATGCCCCTGACAAAGAGG - Intronic
1033882511 7:145902722-145902744 GGAGCTTGGGCCTGGGACAGGGG + Intergenic
1036250179 8:7155415-7155437 GGTGCATGTCCGAGGCACAGAGG + Intergenic
1036367309 8:8132035-8132057 GGTGCATGTCCGAGGCACAGAGG - Intergenic
1036883573 8:12533627-12533649 GGTGCATGTCCGAGGCACAGAGG + Intergenic
1037174094 8:15926726-15926748 GGCTCATGGCCATGGCATGGCGG - Intergenic
1037874395 8:22533535-22533557 GGCCAATAGGCCTGGCACAGTGG + Intronic
1038536975 8:28360408-28360430 GACCCAGGGCCCTGGCACAGGGG + Intronic
1039880405 8:41621997-41622019 GGAGCATGGCCCTGGGGCTGCGG + Exonic
1041170417 8:55136177-55136199 TGAGCATGGGCCAGGCACAGTGG - Intronic
1041919701 8:63168357-63168379 GCTGCAGGGCCCTGGCAGAGTGG - Intergenic
1044880455 8:96718061-96718083 GGGGCATGGCCTGGGCACAGTGG - Intronic
1047560364 8:125980844-125980866 GGTGCCTGGGCCAGGCACAGTGG - Intergenic
1048061552 8:130924371-130924393 GGCTCATTCCCCTGGCACACAGG + Intronic
1048412371 8:134188585-134188607 GGGGCAGTGCCCTGGCAAAGAGG + Intergenic
1049270290 8:141692064-141692086 GGTGCTTGGGCCAGGCACAGTGG - Intergenic
1049438958 8:142600562-142600584 GGCGAAGGGCTCTGCCACAGAGG + Intergenic
1051484070 9:17589315-17589337 GGCACATGGGCCAGGCATAGCGG - Intronic
1054159826 9:61666031-61666053 GCCTCATGACCCTGGCAGAGAGG - Intergenic
1055645185 9:78356454-78356476 GGCCCATGTCCCTGGCAGGGCGG + Intergenic
1057730122 9:97601279-97601301 GGCACATGTCCCTGTCACACAGG - Exonic
1059442677 9:114318376-114318398 GGTGCCTGGTACTGGCACAGTGG - Intergenic
1061379527 9:130245666-130245688 GGCACCTGGCCCGGGCGCAGTGG + Intergenic
1061404452 9:130385692-130385714 AGCCCCTGGTCCTGGCACAGCGG + Intronic
1061584452 9:131556918-131556940 GGTGGATGGGCCAGGCACAGTGG - Intergenic
1061754042 9:132800261-132800283 GGCGCCAGGTCCTGGCACTGGGG - Intronic
1062005246 9:134235574-134235596 TGCGCCTGGCCCTGGACCAGTGG + Intergenic
1062014995 9:134286940-134286962 GGGGCATGGCCCTGGTTCGGAGG - Intergenic
1062265892 9:135686304-135686326 GGAGGGTGGCCCTGGAACAGCGG + Intergenic
1186511769 X:10135008-10135030 GGTGGATGGTCCTGGCAAAGGGG + Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1187608075 X:20908052-20908074 TGCCCATGGGCCGGGCACAGTGG - Intergenic
1189509313 X:41646044-41646066 GGTGCATGTCCGAGGCACAGAGG - Intronic
1191774790 X:64802064-64802086 GGAGCTAGGCCCTGGAACAGGGG - Intergenic
1192330496 X:70171524-70171546 TGCCCTTGGCCCTGGCTCAGAGG + Intergenic
1194839827 X:98726576-98726598 GGAGCAAGGGCCTGGAACAGGGG + Intergenic
1198248113 X:134851246-134851268 AGAGCATGGGCCGGGCACAGTGG + Intronic
1200114302 X:153763389-153763411 TGTGGATGGCCCTGCCACAGGGG + Intergenic
1201417261 Y:13759694-13759716 AACTCATGGGCCTGGCACAGTGG - Intergenic