ID: 1002776910

View in Genome Browser
Species Human (GRCh38)
Location 6:336191-336213
Sequence GAATCAGAGGCCAGACTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 1, 1: 0, 2: 5, 3: 84, 4: 752}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002776910_1002776914 7 Left 1002776910 6:336191-336213 CCACTGAGTCTGGCCTCTGATTC 0: 1
1: 0
2: 5
3: 84
4: 752
Right 1002776914 6:336221-336243 GGCCCAGTGCTATATGCCACAGG 0: 1
1: 0
2: 1
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002776910 Original CRISPR GAATCAGAGGCCAGACTCAG TGG (reversed) Intronic
900219745 1:1501676-1501698 GAAATAGAGGCCAGGCTCTGTGG - Intergenic
900274046 1:1811776-1811798 TATTCATAGGCCAGACGCAGTGG + Intronic
900940164 1:5793408-5793430 GGAACAGAGGCCAGACCCAGCGG + Intergenic
901273286 1:7970454-7970476 GAGTCAGAGGCCAGGGTGAGGGG + Intronic
901745699 1:11371929-11371951 GAAAAAGTGGCCAGGCTCAGTGG - Intergenic
901769683 1:11523997-11524019 GAAGAAGAGGCGAGGCTCAGGGG + Exonic
901908196 1:12432880-12432902 GACTCAGACGCCAGGCACAGTGG - Intronic
902268220 1:15284191-15284213 GAATTGGAGGCCAGGCACAGCGG + Intronic
902427741 1:16337917-16337939 GAATAATAGGCCAAACACAGTGG + Intronic
902561291 1:17279237-17279259 GACACAGAGGCCAGACACAGAGG + Intronic
902630608 1:17702330-17702352 GAATTAGAGGCCAGGCACAGTGG - Intergenic
902740357 1:18433613-18433635 GACTCAGGGGCCAGGCACAGTGG + Intergenic
902907020 1:19565805-19565827 GAATGAGGGGCCAGGCACAGTGG + Intergenic
902984763 1:20148699-20148721 GCAACAGAGGCCCCACTCAGAGG - Exonic
903198934 1:21717113-21717135 GAAGTAGAGGCCAGGCACAGTGG + Intronic
903723646 1:25424673-25424695 CAATCAGAGGCCAGGCACAGTGG - Intronic
903969849 1:27111506-27111528 GCAACATAGGCCAGACACAGTGG + Intronic
904242080 1:29153886-29153908 AAATCAGAGGCCGGGCACAGTGG - Intronic
905427970 1:37899271-37899293 AATTCTGAGGCCAGACGCAGTGG + Intronic
905491769 1:38349821-38349843 GAAATAGAGGCCAGAGTCTGAGG - Intergenic
906031319 1:42722622-42722644 GAATCAGAGGCCGGGCACAGTGG + Intergenic
906175931 1:43772333-43772355 GGATCACTGGCCAGACGCAGTGG - Intronic
906231273 1:44166687-44166709 GGATGAGAGGCCAGGCACAGTGG - Intergenic
907100556 1:51830248-51830270 GAAATAAAGGCCAGACGCAGTGG - Intronic
907373033 1:54015255-54015277 CAATAACAGGCCAGACACAGTGG - Intronic
907432221 1:54419621-54419643 GAAAAAGAGGCCAGGCGCAGTGG + Intergenic
908041930 1:60123229-60123251 AAATCATAGGCCAGGCGCAGTGG - Intergenic
908123081 1:61004178-61004200 TAGACAGAGGCCAGGCTCAGTGG - Intronic
908212352 1:61914166-61914188 TAATGATAGGCCAGGCTCAGTGG + Intronic
908367294 1:63438784-63438806 GAAACAGAGGCCAGGCACAGCGG + Intergenic
908442857 1:64172030-64172052 GATAAAGAGGGCAGACTCAGTGG - Intronic
909036951 1:70604336-70604358 GAATCAGAGGCTTCACTCACGGG - Intergenic
909561772 1:77015944-77015966 GGATCAGAGGCCTGGCTCTGAGG - Intronic
910011961 1:82475347-82475369 GAACAAGAGGTCAGAGTCAGAGG + Intergenic
910105779 1:83629741-83629763 GAAGCAGAGTATAGACTCAGTGG - Intergenic
910662003 1:89683639-89683661 TAATTAGTGGCCAGGCTCAGTGG - Intronic
911598128 1:99819746-99819768 GAGAAACAGGCCAGACTCAGTGG + Intergenic
912469905 1:109899502-109899524 GCATCAGGGGCCAGACTCAATGG + Intergenic
912534189 1:110352515-110352537 CTATCAGAGGCCAGGCACAGTGG + Intergenic
912640593 1:111341704-111341726 GAATCACAGGCCTGACTACGCGG - Intergenic
912792753 1:112668762-112668784 GAAGCAGAGGCCAGGTACAGTGG - Intronic
913134833 1:115878138-115878160 GAAAAAGAGGCCAGGCGCAGTGG - Intergenic
913669650 1:121084569-121084591 GTATCAGTGGCCAGGCGCAGTGG + Intergenic
914228851 1:145745937-145745959 AAATAAGAGGCCAGGCGCAGTGG + Exonic
914460165 1:147876495-147876517 GAATTACAGGCCAGGCGCAGTGG + Intergenic
914659898 1:149779886-149779908 GTATCAGTGGCCAGGCGCAGTGG + Intergenic
914849227 1:151301810-151301832 GAAGGAGAGGCCAGGCACAGTGG - Intronic
914916793 1:151824020-151824042 GATGCAGAGGCCCAACTCAGAGG - Intronic
915810437 1:158903729-158903751 GAAAAAGAGGCCAGGCACAGTGG + Intergenic
916312531 1:163412818-163412840 AGATCAGAGGCCAGGCACAGTGG + Intergenic
916793366 1:168143742-168143764 GAATAAGAAGCCAGGCACAGTGG + Intergenic
916880479 1:169015525-169015547 GAGTGGGAGGCCAGACTCAGAGG + Intergenic
917429940 1:174955792-174955814 GAATCATAGGCTAGGCACAGTGG + Intronic
917758768 1:178132342-178132364 GAAAAAGAGGCCAGTCACAGTGG - Intronic
917779603 1:178379226-178379248 GAAACAGAGGCTAGACACAGTGG + Intronic
917930252 1:179817880-179817902 GAATCAGAAACCAGACCCTGAGG + Intergenic
917961153 1:180145982-180146004 GAATTACAGGCCAGGCACAGTGG + Intergenic
918121856 1:181547283-181547305 GCATCGGTGGCCAGAGTCAGGGG - Intronic
918599619 1:186340716-186340738 AAATCTGAGGCCAGACACGGTGG - Intronic
919112311 1:193236605-193236627 AAATCATTGGCCAGACACAGTGG + Intronic
919677256 1:200395801-200395823 TAATTATAGGCCAGACACAGTGG + Intergenic
919693928 1:200553221-200553243 TTATCAAAGGCCAGACACAGTGG - Exonic
920744630 1:208615064-208615086 GAATCAGGGGCCAGGGGCAGTGG - Intergenic
921169711 1:212535895-212535917 GAATTCAAGGCCAGGCTCAGTGG + Intergenic
921637195 1:217510803-217510825 GAATTAGAGGCCAGGTGCAGTGG + Intronic
921660149 1:217791837-217791859 GGGTCAGAGGCCAGAGTCACTGG + Intronic
921862886 1:220057385-220057407 GATTCACAGGCCAGGCGCAGTGG - Intergenic
922185617 1:223271697-223271719 GGATCAGATGCCAGACTTTGTGG - Intronic
922563273 1:226584555-226584577 AGATGAGAGGCCAGACTCTGAGG - Intronic
922587861 1:226749243-226749265 GAAATAGAGACCAGGCTCAGTGG + Intergenic
922660284 1:227424087-227424109 AAATGAGAGGCCAGGCGCAGTGG - Intergenic
922708164 1:227802602-227802624 GAGTCAAAAGCCTGACTCAGTGG + Intergenic
922770489 1:228179866-228179888 GAATGAGGGGCCAGGCGCAGTGG + Exonic
923507201 1:234614856-234614878 GTGTCAGAGGCCAGACGCGGTGG + Intergenic
923570153 1:235106337-235106359 GAAAAAGAGGCCAGGCACAGTGG - Intergenic
923615833 1:235536410-235536432 GCATCAAAGGCCAGGCACAGTGG + Intergenic
923703106 1:236318576-236318598 GACCCTGAAGCCAGACTCAGTGG - Intergenic
924213861 1:241799076-241799098 TAATGACAGGCCAGGCTCAGTGG + Intronic
924231684 1:241967273-241967295 AAACCAGAGGCCAGACGCGGTGG + Intergenic
924770122 1:247072495-247072517 AAACCACAGGCCAGGCTCAGTGG + Intronic
1063131346 10:3180387-3180409 AAATCTGAGGCCAGGCACAGTGG - Intergenic
1063142830 10:3270855-3270877 GAATCACAGGCCAGGCTATGAGG - Intergenic
1063373306 10:5536054-5536076 GAATGTGAGGCCAGCCGCAGTGG - Intergenic
1063484796 10:6409580-6409602 GAAAAAGAGGCCAGGCGCAGTGG - Intergenic
1063558014 10:7099244-7099266 AAATGAGAGGCCAGGCACAGTGG + Intergenic
1064115570 10:12574603-12574625 GAATCCCAGGCCAGATGCAGTGG - Intronic
1064403020 10:15036791-15036813 GAATTGTAGGCCAGACGCAGTGG + Intronic
1064726994 10:18290312-18290334 GAAAAGGAGGCCAGGCTCAGTGG - Intronic
1064944244 10:20770519-20770541 GAGTCAGAGGAGAGACACAGGGG + Intergenic
1065006704 10:21387087-21387109 CATTTAGAGGCCAGACACAGTGG + Intergenic
1065402624 10:25323130-25323152 CAATCAGAGGCCAGGCGCGGTGG - Intronic
1065473329 10:26106567-26106589 AAATCAGAAACTAGACTCAGAGG - Intronic
1065868517 10:29935245-29935267 GAGTAGGGGGCCAGACTCAGTGG - Intergenic
1065944346 10:30593375-30593397 GGAGCAGAGACCAGGCTCAGAGG + Intergenic
1065961691 10:30738953-30738975 GAAGCATAGGCCAGGCACAGTGG + Intergenic
1066052323 10:31647208-31647230 GCATCTGAGGCCAGGCGCAGTGG + Intergenic
1066079390 10:31915097-31915119 GAAGCTGAGGCCAGGCGCAGTGG + Intronic
1066081574 10:31935763-31935785 GAAACAAAGGCCAGGCACAGTGG + Intergenic
1066689838 10:38015160-38015182 GAATTGGAGGCCAGGCACAGTGG - Intronic
1067002873 10:42634115-42634137 GAATCAGAGGCTAAGCACAGTGG + Intronic
1067302377 10:45023690-45023712 GAATCAGAAGCAAGACTGAGAGG + Intergenic
1067594943 10:47548586-47548608 GAAAAAAAGGCCAGACACAGTGG - Intronic
1068279810 10:54854265-54854287 GAGTCACAGCCCTGACTCAGGGG + Intronic
1068322533 10:55438120-55438142 GAAAGAGAGGCCAGGCGCAGGGG - Intronic
1068336195 10:55634839-55634861 TAATCATAGGCCAAACCCAGGGG - Intergenic
1069519806 10:69109894-69109916 GGATCAGAGGCCAGGCGCAGTGG + Intergenic
1070034492 10:72708862-72708884 TAATTTGAGGCCAGGCTCAGTGG + Intronic
1070642667 10:78180690-78180712 CAATCAGAGGCCAGTCTCTTTGG + Intergenic
1070666190 10:78345828-78345850 AAGTCAGAGGCCAGGCACAGTGG - Intergenic
1070898153 10:80003677-80003699 AAATGACAGGCCAGACCCAGTGG + Intergenic
1071748647 10:88450412-88450434 GAATCTCAGGTCAGACTCACAGG + Intronic
1071868901 10:89769867-89769889 GAATTAGAGACCAGAGTGAGGGG + Intronic
1072187079 10:93050261-93050283 GAGTTAAAGGCCAGACGCAGTGG + Intronic
1072592705 10:96842106-96842128 GAAAGAGAGGCCAGGCACAGTGG + Intronic
1073416684 10:103389608-103389630 TAATCTGAGGCCAGGCACAGTGG - Intronic
1073437814 10:103531805-103531827 GAGACAGAGGCCAGGCACAGTGG - Intronic
1073495347 10:103885675-103885697 GAATCTAAGGCCAGGCACAGTGG - Intronic
1074080156 10:110162104-110162126 GGTGCAGAGGCCAGGCTCAGTGG + Intergenic
1074271293 10:111956441-111956463 GAATCAGTGGCCAGAGCCATAGG - Intergenic
1074554068 10:114472128-114472150 TTATCAGAGGCCAGACTTGGGGG - Intronic
1075030049 10:119017388-119017410 TAATGTGAGGCCAAACTCAGTGG - Intergenic
1076518342 10:131062638-131062660 GAATCAGACCCCAGCCCCAGGGG - Intergenic
1077454492 11:2670323-2670345 GTAGCAGAGTTCAGACTCAGTGG + Intronic
1077507326 11:2936342-2936364 CAAAAAGAGGCCAGGCTCAGTGG - Intergenic
1077515681 11:3000660-3000682 GAACCCGAGGGCAGACTGAGCGG + Intergenic
1077775764 11:5269953-5269975 GAATAAAAGGCCAGACAGAGAGG - Exonic
1078510066 11:11978338-11978360 GAAGCACAGGCCAGAATCTGGGG - Intronic
1078714265 11:13824964-13824986 CTATCAAATGCCAGACTCAGCGG + Intergenic
1078748485 11:14137833-14137855 TTAGCAGAGGCCAGATTCAGAGG - Intronic
1079034430 11:17010098-17010120 GACTCCGAGGCCAGGCACAGTGG + Intronic
1079212434 11:18474672-18474694 GCATCAGAGGCCAGGTGCAGTGG - Intronic
1079689027 11:23399828-23399850 GAATTAGAGGCCAGACCAAGTGG + Intergenic
1079719665 11:23793764-23793786 GCATCAGAGAACACACTCAGGGG + Intergenic
1079845838 11:25466667-25466689 AAATAATAGGCCAGACGCAGTGG + Intergenic
1079895000 11:26107696-26107718 TAAGCAGAGGTCAGACTCAATGG - Intergenic
1081041554 11:38220704-38220726 GAAGCATAGGCCAGGCGCAGAGG + Intergenic
1081510875 11:43771752-43771774 GAATGTGAGGCCAGGCGCAGTGG - Intronic
1081612785 11:44573036-44573058 GACACATAGGGCAGACTCAGTGG - Intronic
1082218161 11:49600211-49600233 CCATCAGAGGCCAGGCACAGTGG - Intergenic
1082718720 11:56646956-56646978 TTATCAGTGGCCAGGCTCAGTGG + Intergenic
1083767715 11:64849838-64849860 GAAGCAGCTCCCAGACTCAGTGG - Intergenic
1083906890 11:65678475-65678497 CAACCTGAGGCCAGGCTCAGTGG - Intergenic
1083957181 11:65990812-65990834 TAAATATAGGCCAGACTCAGTGG + Intergenic
1084043020 11:66553581-66553603 GAAAAAGAGGCCAGACACGGTGG + Intronic
1084097939 11:66924749-66924771 GAATAATAGGCTAGGCTCAGTGG - Intronic
1084598909 11:70133366-70133388 GAATCACAGGCCATACTTCGAGG - Intronic
1084602255 11:70152812-70152834 GACACAGAGGCCAGATTCGGTGG + Intronic
1084879984 11:72163986-72164008 GAATTATCAGCCAGACTCAGTGG + Intergenic
1085426561 11:76409967-76409989 AAAACTCAGGCCAGACTCAGTGG + Intronic
1085665304 11:78410214-78410236 AAATCAGAGGCCAGGTGCAGCGG + Intronic
1085873220 11:80375195-80375217 GAATCAGAAGACAGAAGCAGAGG + Intergenic
1086437716 11:86798980-86799002 GAGACATAGGCCAGGCTCAGTGG - Intronic
1086631410 11:89023936-89023958 CCATCAGAGGCCAGGCACAGTGG + Intronic
1086688407 11:89760312-89760334 GTATCTGGGGCCAGACCCAGTGG + Intergenic
1086717453 11:90079633-90079655 GTATCTGGGGCCAGACCCAGTGG - Intergenic
1087043646 11:93825947-93825969 GAAATAAAGGCCAGGCTCAGTGG + Intronic
1087435076 11:98106171-98106193 GATTAAGAGGCCAGGCGCAGTGG + Intergenic
1088213752 11:107484903-107484925 AAAACAGAGGCCAGGCACAGTGG + Intergenic
1088310498 11:108455528-108455550 CAATTAGAGGCCAGGCACAGTGG + Intronic
1088416103 11:109590695-109590717 GAATCAGATCCCCGACTTAGGGG + Intergenic
1088831843 11:113543565-113543587 GAAGAAGAGTCCAGCCTCAGAGG - Intergenic
1090485104 11:127106106-127106128 GAATCAGGTGCCAGACTCATAGG + Intergenic
1090875281 11:130783535-130783557 GAGCCAGGGCCCAGACTCAGGGG + Intergenic
1091922541 12:4317155-4317177 GAATCAGGGGCCAGGCGCGGTGG - Intergenic
1092370474 12:7912784-7912806 AAATAAGAGGCCAGGCGCAGTGG - Intergenic
1092762891 12:11825513-11825535 GAAACAGAGGAGAGACGCAGAGG - Intronic
1093482729 12:19621975-19621997 CAAACAGAGGCCAGGCGCAGTGG + Intronic
1093576978 12:20742820-20742842 AAATCAGAGGCCAGGCGCGGTGG - Intronic
1094094566 12:26689127-26689149 GAAAAAGAGGCCAGGCACAGTGG + Intronic
1094520066 12:31176836-31176858 GAATAAGTGGCCAGGCGCAGGGG - Intergenic
1095922530 12:47545045-47545067 GAATTAGAGGCCAGGCACAGTGG + Intergenic
1096136290 12:49204432-49204454 TAATAATAGGCCAGTCTCAGTGG - Intronic
1096270516 12:50162889-50162911 GAAAGAGAGGCCAGGCACAGTGG - Intronic
1096483201 12:51957158-51957180 GTATCATAGGCCAGGCACAGTGG + Intronic
1096486782 12:51988180-51988202 GACTAAGAGGCCAGGCGCAGTGG + Intronic
1096571788 12:52527614-52527636 GACTCTGGGGCAAGACTCAGGGG + Intergenic
1096808451 12:54154924-54154946 CAAGCAAAGGCCAGTCTCAGTGG + Intergenic
1097038756 12:56141809-56141831 GAAGGACAGGCCAGACACAGTGG + Intronic
1097298500 12:57993085-57993107 GAATCTCAGCCCTGACTCAGGGG + Intergenic
1097298701 12:57995542-57995564 TGATCAGAGGCCAGGCACAGTGG - Intergenic
1098178087 12:67814570-67814592 AAAGCAGAGGCCAGGCACAGTGG - Intergenic
1098460731 12:70730543-70730565 AAATCAGAGGCCAGGCACAGTGG + Intronic
1098879872 12:75906241-75906263 GATTTATAGGCCAGACACAGTGG + Intergenic
1099254203 12:80295462-80295484 CAATCATAGGCCAGACGCGGTGG - Intronic
1099485353 12:83223037-83223059 GACACAGAGGCCAGGCACAGTGG + Intergenic
1100002415 12:89853443-89853465 GAATCAGAGGCCCGGCGTAGTGG - Intergenic
1100700896 12:97146559-97146581 AAAATAGAGGCCAGGCTCAGTGG - Intergenic
1101054242 12:100895847-100895869 AAATCAAAGGCCAGGCACAGTGG - Intronic
1101662942 12:106782681-106782703 TGATCAGAGGGAAGACTCAGAGG - Intronic
1102021178 12:109684069-109684091 AAGTCAGAGGCCAGGCACAGTGG - Intergenic
1102169551 12:110831868-110831890 CAATCATAGGCCAGGCACAGTGG - Intergenic
1102181637 12:110917131-110917153 GAATCACGGGCCAGGCACAGTGG - Intronic
1102690364 12:114755791-114755813 GCATCATGGGCCAGGCTCAGTGG + Intergenic
1102919905 12:116784105-116784127 GATTAAGAGCTCAGACTCAGGGG - Intronic
1103118969 12:118364618-118364640 AAATAAGAGGCCAGGCACAGTGG + Intronic
1103357098 12:120329776-120329798 AGATCAGAGGCCAGGCACAGTGG - Intergenic
1103878077 12:124144329-124144351 AAATCAGAGGCCAGGCGCTGTGG - Intronic
1103991355 12:124801493-124801515 GAATCAGAGGCCAGGCACGGTGG + Intronic
1107763242 13:43704568-43704590 GAGTCAGAGGACAGAGTCTGAGG + Intronic
1108253180 13:48587187-48587209 TAATCTGAGGCCAGGCACAGTGG + Intergenic
1108302299 13:49090712-49090734 GTACCATAGGCCAGGCTCAGTGG + Intronic
1108334339 13:49423428-49423450 GAATTAGAGGCCAGGGACAGTGG + Intronic
1108645133 13:52419951-52419973 GAATAAGAGGCCAGATGCAGTGG + Intronic
1108685703 13:52817361-52817383 GAGTCAGAGAACAGAGTCAGAGG + Intergenic
1108868365 13:54949940-54949962 GACTCAGAGGCCAGATGCAGAGG + Intergenic
1109136985 13:58664296-58664318 GAATGAGATGACTGACTCAGTGG + Intergenic
1109880741 13:68471385-68471407 GAATTAGAGGCCAGGCGCAGTGG - Intergenic
1109911426 13:68916733-68916755 TAATTTGAGGCCAGACACAGTGG - Intergenic
1109919701 13:69040338-69040360 CAATCAGAGGCCAGGCACGGTGG + Intergenic
1111660455 13:91203703-91203725 GACTCAGATGCTAGACTAAGAGG + Intergenic
1112260429 13:97873261-97873283 GGATGACAGGCCAGACACAGTGG + Intergenic
1112848298 13:103671666-103671688 AAATCAGAGGCCGGGCGCAGTGG - Intergenic
1113195025 13:107792958-107792980 CAAAAAGAGGCCAGGCTCAGTGG - Intronic
1113259208 13:108543355-108543377 GAATCCCAGGCCGGGCTCAGTGG + Intergenic
1114028686 14:18555491-18555513 GAAACATAGGCAAAACTCAGTGG - Intergenic
1114447618 14:22801494-22801516 GTATCAGAGGCCAGGCACGGTGG + Intronic
1114613898 14:24058361-24058383 GGAAAAGAGGCCAGACTGAGAGG - Intronic
1116893156 14:50288716-50288738 AAAACAGAGGCCAGGCACAGTGG - Intronic
1117212357 14:53513670-53513692 GAATCAGAGGCAAGATATAGAGG - Intergenic
1117251008 14:53937479-53937501 GTAACAGAGGCCTAACTCAGTGG - Intergenic
1118628858 14:67684677-67684699 GAATTTGAGGCCAGGCGCAGTGG - Intronic
1119326372 14:73761945-73761967 CAAGCAGAGGCCAGACTCTCAGG + Intronic
1119871825 14:78024311-78024333 AGATCAGAGGCCAGGCACAGTGG - Intergenic
1120022245 14:79543881-79543903 TAATTAGATGCCAGAATCAGGGG - Intronic
1121542001 14:94735101-94735123 TAACAAGAGGCCAGACACAGTGG - Intergenic
1122197883 14:100103123-100103145 AAATCAGAGGCAAGATTCTGTGG + Intronic
1122227727 14:100289553-100289575 AAATCAGAGGCCGGGCGCAGTGG + Intergenic
1124471137 15:29987050-29987072 GAATCGCAGGCCAGGCACAGTGG - Intergenic
1124599774 15:31124364-31124386 CAATCTGAGGCCAGGCACAGTGG + Intronic
1124605238 15:31164892-31164914 GAAAAAGAGGCCAGGCGCAGTGG + Intergenic
1124838739 15:33221783-33221805 GAATCAGAGTCCAGGCACAGTGG + Intergenic
1125143920 15:36443540-36443562 GATTAAAAGGCCAGGCTCAGTGG + Intergenic
1125500385 15:40236588-40236610 TAATAATAGGCCAGACGCAGTGG - Intergenic
1125660886 15:41393856-41393878 GAATTAGAGGCCAGGCGCGGTGG - Intronic
1125949574 15:43740583-43740605 AAAACAGAGGCCAGGCACAGTGG + Intergenic
1125983783 15:44029080-44029102 GAATAAGAGGCCATAGTGAGAGG + Intronic
1126016538 15:44356881-44356903 GAATTATAGGCCAGGCACAGTGG + Intronic
1126016767 15:44359298-44359320 CAATTAGAGGCCAGGCGCAGTGG + Intronic
1126553553 15:49960843-49960865 GAACCAGAGGCCGGGCGCAGTGG + Intronic
1126590920 15:50338881-50338903 GAACCATAGGCCAAACACAGTGG + Intronic
1126613702 15:50554997-50555019 AAATAAGAGGCCAGGCGCAGTGG - Intronic
1126831753 15:52614391-52614413 TAATTATAGGCCAGGCTCAGTGG - Intronic
1128061937 15:64740865-64740887 GAATCCCAAGCCTGACTCAGTGG - Exonic
1128768810 15:70266828-70266850 CTGTCAGAGGCCAGCCTCAGCGG - Intergenic
1129147355 15:73660817-73660839 GAATCACTGGCCAGGCACAGTGG + Intergenic
1129916643 15:79279977-79279999 GATTAAGAGCACAGACTCAGGGG - Intergenic
1129981855 15:79879693-79879715 GAAGCAGAGGCCTAAATCAGTGG + Intronic
1130076044 15:80691285-80691307 GAATGAGAGGCCAGGTGCAGGGG - Intronic
1130709592 15:86266613-86266635 GAATCATCGGCCAGGCGCAGTGG + Intronic
1131013120 15:89035112-89035134 GAATCTGAGGCCAGACGCCGTGG - Intergenic
1131196338 15:90358171-90358193 GGATAAGAGGCCAGGCTCAGTGG - Intronic
1132561371 16:595886-595908 CAATTAGAGGCCAGGCACAGTGG - Intronic
1132760266 16:1505570-1505592 GGATCAGAAGCAAGACCCAGCGG + Exonic
1132811892 16:1803854-1803876 CCATCAGGGGCCAGACACAGTGG - Intronic
1132813244 16:1812216-1812238 GAATGACAGGCCAGGCACAGTGG + Intronic
1133011951 16:2918124-2918146 GAATCCAAGGCCAGGCACAGTGG - Intronic
1133070305 16:3242380-3242402 GAATCATAGGCCGGGCACAGTGG + Exonic
1133759810 16:8789478-8789500 GAAAAACAGGCCAGACCCAGTGG + Intronic
1133804698 16:9115895-9115917 GAATCCAAGGCCAGGCGCAGTGG - Intronic
1134117465 16:11560007-11560029 AAAAAAGAGGCCAGACACAGTGG + Intronic
1134440017 16:14293878-14293900 GAATGACAGGCCAGGCGCAGTGG - Intergenic
1134506561 16:14812416-14812438 GAATTTGAGGCCAGGCACAGTGG - Intronic
1134573994 16:15316404-15316426 GAATTTGAGGCCAGGCACAGTGG + Intergenic
1134728424 16:16439913-16439935 GAATTTGAGGCCAGGCACAGTGG - Intergenic
1134939017 16:18272005-18272027 GAATTTGAGGCCAGGCACAGTGG + Intergenic
1135593741 16:23725445-23725467 ATATTAGAGGCCAGGCTCAGTGG + Intergenic
1135599390 16:23769132-23769154 GAGGCAGAGGCCAGGTTCAGTGG - Intergenic
1135701049 16:24632719-24632741 AAATCTGGGGCCAGACACAGTGG + Intergenic
1136086910 16:27891758-27891780 GAATCTGAGGCCAGTCACGGTGG - Intronic
1136140672 16:28286385-28286407 AAATCACAGGCCAGGCACAGTGG + Intergenic
1136347786 16:29687414-29687436 GAATCAGAGCCCAGGCTCTGGGG + Intronic
1136368907 16:29823564-29823586 GAGTCAGAGGCCAGGCGCGGTGG + Intronic
1136854423 16:33642616-33642638 GTATCACAGACCAGACACAGTGG - Intergenic
1137232287 16:46577757-46577779 AAATCACAGGCCAGGCACAGTGG - Intergenic
1137657960 16:50176792-50176814 GAATTATAGGCCAGGCACAGTGG - Intronic
1138107441 16:54296232-54296254 GAGCCAGAGGCCAGGCACAGTGG - Intergenic
1138147028 16:54622067-54622089 AAATATGAGGCCAGACACAGTGG + Intergenic
1138462801 16:57162187-57162209 TAATCACAGGCCAGGCGCAGTGG - Intronic
1138742262 16:59324469-59324491 GAATTAGAGGCCAGGCGCGGTGG - Intergenic
1139963315 16:70730339-70730361 GGATCAGAGACCTTACTCAGGGG - Intronic
1140099497 16:71903266-71903288 AAAGAAGAGGCCAGGCTCAGTGG - Intronic
1140142788 16:72274540-72274562 GAATCTGAGGCCAGGCATAGTGG - Intergenic
1140873101 16:79124808-79124830 GGAACAGAGTCCAGACTCATTGG - Intronic
1141187695 16:81799575-81799597 TAATAACAGGCCAGGCTCAGTGG - Intronic
1141460630 16:84176767-84176789 GAATCACAGGCCAGTCCTAGTGG + Intronic
1141567629 16:84913861-84913883 AAAACAGAGGCCAGGCACAGTGG - Intronic
1141591191 16:85069875-85069897 GAATTTGTGGCCAGGCTCAGTGG + Intronic
1142115758 16:88355361-88355383 GAACCAGAGGCCACTTTCAGGGG - Intergenic
1142162466 16:88565528-88565550 AAATGAGAGGCCAGGCACAGTGG + Intergenic
1142661051 17:1429636-1429658 AAAAAAGAGGCCAGACGCAGTGG + Intronic
1142878552 17:2867185-2867207 CAATCAGAGGCCAGGCACGGTGG - Intronic
1142964672 17:3573209-3573231 GCACCAGAGGCCAGACTCAGGGG - Intronic
1143285071 17:5782731-5782753 GCATCTGAGGCCAGGCACAGTGG - Intronic
1143290862 17:5827274-5827296 GAACCAGAGGACAGAGACAGAGG + Intronic
1143497370 17:7320115-7320137 GAAAAAAAGGCCAGGCTCAGTGG - Intronic
1143511757 17:7400027-7400049 GAGTCAGAGGCCAGGCACAGTGG + Intronic
1143955740 17:10667392-10667414 GAATCAGAGGCCGGGTGCAGTGG + Intergenic
1143979787 17:10858789-10858811 GAATAAGAGGCCAGGCACGGTGG - Intergenic
1144336756 17:14278365-14278387 CAATCAGAGGCCAGGCACAGTGG - Intergenic
1144432542 17:15207542-15207564 CAATCTGAGGCCAGGCGCAGTGG - Intergenic
1144538051 17:16111292-16111314 GAAACACAGGCCAGGCGCAGTGG + Intronic
1144666483 17:17105580-17105602 GCCTCAGTGGCCTGACTCAGTGG - Intronic
1144693569 17:17285689-17285711 GAGTTAGAGGCCAGGCACAGTGG - Intergenic
1144878387 17:18416210-18416232 GAATCACAGGCCACATGCAGTGG + Intergenic
1144932602 17:18871945-18871967 CAATCATAGGCCAGGCACAGTGG - Intronic
1145054766 17:19694628-19694650 GGATCAGAGGCCAGGCGCTGTGG + Intronic
1145153844 17:20528183-20528205 GAATCACAGGCCACATGCAGTGG - Intergenic
1145198843 17:20921522-20921544 GAATCACAGGCCAGGTGCAGTGG + Intergenic
1145758553 17:27410583-27410605 AAAACACAGGCCAGACACAGTGG - Intergenic
1145823853 17:27861715-27861737 CAATAAGAGGCCAGGCACAGTGG + Intronic
1145853013 17:28121784-28121806 GAATGTCAGGCCAGGCTCAGTGG - Intronic
1146024340 17:29306617-29306639 AAATCAGAGGCCAGACACGGTGG + Intergenic
1146070374 17:29675504-29675526 GAATAAGAGGCCAGGTGCAGTGG + Intronic
1146218736 17:30999949-30999971 GAACCTGAGGGCAGTCTCAGAGG + Intergenic
1146651388 17:34608968-34608990 GGATCTGAGTCCAAACTCAGAGG - Intronic
1146844672 17:36175177-36175199 GAAAAAGGGGCCAGACCCAGTGG + Intronic
1146856978 17:36263112-36263134 GAAAAAGGGGCCAGACCCAGTGG + Intronic
1146863639 17:36325263-36325285 GAAAAAGGGGCCAGACCCAGTGG - Intronic
1146872888 17:36387022-36387044 GAAAAAGGGGCCAGACCCAGTGG + Intronic
1146880246 17:36438108-36438130 GAAAAAGGGGCCAGACCCAGTGG + Intronic
1147066499 17:37925851-37925873 GAAAAAGGGGCCAGACCCAGTGG - Intronic
1147075772 17:37987647-37987669 GAAAAAGGGGCCAGACCCAGTGG + Intronic
1147078031 17:38005412-38005434 GAAAAAGGGGCCAGACCCAGTGG - Intronic
1147087297 17:38067193-38067215 GAAAAAGGGGCCAGACCCAGTGG + Intronic
1147093967 17:38129347-38129369 GAAAAAGGGGCCAGACCCAGTGG - Intergenic
1147103242 17:38191156-38191178 GAAAAAGGGGCCAGACCCAGTGG + Intergenic
1147283362 17:39381190-39381212 AAATAACAGGCCAGACACAGTGG + Intronic
1147409456 17:40239018-40239040 TAAACAGAAGCCAGACACAGTGG - Intronic
1148342791 17:46883570-46883592 GGATCATAGGCCAGGCACAGTGG - Intronic
1148477862 17:47941139-47941161 GAATTAGGGGCCAGACTCTGAGG - Intergenic
1148660780 17:49330761-49330783 AAATCAGAGGCCGGGCACAGTGG + Intronic
1149734350 17:58978421-58978443 GAATGAGAGGCCAGATGCGGTGG + Intronic
1149847817 17:60017625-60017647 GAAAAAGGGGCCAGACCCAGTGG + Intergenic
1150065711 17:62107442-62107464 TAATCAGAGGCCAGTCACAGTGG + Intergenic
1150086173 17:62274242-62274264 GAAAAAGGGGCCAGACCCAGTGG + Intronic
1150152652 17:62823144-62823166 GGTTCAGAGGCCAGGCACAGAGG + Intergenic
1150317933 17:64185634-64185656 TCATCAGAGGCCAGGCACAGTGG + Intronic
1151279837 17:73065115-73065137 CAAAAAGAGGCCAGGCTCAGTGG + Intronic
1151563124 17:74881408-74881430 GAAACAGAGGCCAGGCTCGATGG + Intronic
1152343140 17:79736324-79736346 GAAGGAGAGGCCAGACGCAGTGG - Intronic
1152671211 17:81608175-81608197 GACTCAGAGGCCAGGCTCTGGGG + Intronic
1152790088 17:82273986-82274008 GAGTGACAGGCCAGGCTCAGGGG + Intergenic
1152816969 17:82413580-82413602 AAATTAGAGGCCAGGCGCAGTGG + Intronic
1153152179 18:2107886-2107908 GTAACAGTGGCCAGACACAGTGG - Intergenic
1153242422 18:3043036-3043058 AAATGAGAGGCCAGACGTAGTGG - Intergenic
1153277919 18:3386470-3386492 GTATCAGAGGCCAGATGCGGTGG + Intergenic
1153477093 18:5509002-5509024 GCAGCAGAGGCCAGCTTCAGAGG + Intronic
1153780521 18:8491480-8491502 GAAGCAGTGGTCAGAGTCAGAGG + Intergenic
1154080866 18:11255175-11255197 GAATCTGAGGCAAGAGCCAGAGG + Intergenic
1154225431 18:12499050-12499072 AAATAAAAGGCCAGACACAGTGG - Intronic
1154421487 18:14233222-14233244 GAATAAGCGGCCAGGCACAGTGG - Intergenic
1154497500 18:14973113-14973135 AAATCTGAGGCCAGGCACAGTGG - Intergenic
1155147775 18:23098199-23098221 GAATTGGAGGCCAGTCACAGTGG + Intergenic
1155172144 18:23274768-23274790 GAATCAGATGTGAGACTGAGAGG - Intronic
1155348747 18:24885072-24885094 TAATAAGAAGCCAGACTCATGGG + Intergenic
1155656968 18:28203863-28203885 TGATCAGAGGCCGGGCTCAGTGG - Intergenic
1155793732 18:30006877-30006899 GAATCTGAGGCCAGCCACAGTGG - Intergenic
1155866590 18:30973293-30973315 GAAAAAGAGGCCAGGCTCGGTGG - Intergenic
1155989610 18:32266428-32266450 GAATCTGGGGCCAGACTCTCAGG + Intronic
1156055809 18:33001230-33001252 AAAGCAGAGGCCAGGCGCAGTGG + Intronic
1156716064 18:40011981-40012003 AAATAAGAGGCCAGGCACAGTGG - Intergenic
1157358281 18:46954938-46954960 GAAGCAGAGGCCAGGCACAGTGG - Intronic
1157662231 18:49455662-49455684 GGAGCAGAGGCCAGGCGCAGTGG + Intronic
1157788726 18:50510488-50510510 GAATCCTAGGCCAGGCACAGTGG - Intergenic
1158984672 18:62801737-62801759 CAAACAGAGGCCAGGCACAGTGG - Intronic
1159358322 18:67365957-67365979 GATCCAGATGCCAGCCTCAGGGG + Intergenic
1159486825 18:69071847-69071869 AAATCAGAGGTCAGAGTCTGGGG - Intergenic
1159575185 18:70167444-70167466 GCCACAGAGGCCAGACCCAGTGG + Intronic
1160118725 18:76107914-76107936 AAATCATAGGCCAGGCACAGTGG - Intergenic
1160965320 19:1744753-1744775 GAATCCTGGGCCAGGCTCAGAGG - Intergenic
1161281527 19:3448358-3448380 GAAACAGAGGCCAGGCACAGTGG - Intronic
1161523760 19:4740532-4740554 AAGTCAGAGGCCAGTCACAGTGG - Intergenic
1161787470 19:6336186-6336208 GAAAAAGAGGCCAGGCACAGTGG - Intergenic
1161906949 19:7163788-7163810 GAATTCGAGGCCAGGCACAGTGG + Intronic
1161917300 19:7238330-7238352 GAAAAAGAGGCCAGGCTCAGTGG + Intronic
1162215193 19:9128235-9128257 GAATCAGTGCCAAGGCTCAGGGG - Intergenic
1162274580 19:9642738-9642760 GAAATAGAGGCCAGGCACAGTGG + Intronic
1162534905 19:11257282-11257304 GGGTCAGAGGCCAGGCACAGTGG - Intronic
1162588161 19:11574193-11574215 CAAGCAGAGGCCAGGCTCAGTGG - Intronic
1162769423 19:12940186-12940208 GATTCAGAGGTCAGCCTCATTGG + Intronic
1163241228 19:16065051-16065073 GAATAAAAGGCCAGGCACAGTGG + Intergenic
1163539227 19:17897116-17897138 GAATCCCTGGCCAGACGCAGTGG - Intergenic
1164262396 19:23579410-23579432 AAAACAGAGGCCAGGCACAGTGG - Intronic
1164272928 19:23689238-23689260 GTGTCAGAGGCCAGGCGCAGTGG + Intergenic
1164486395 19:28659232-28659254 TAATCTGAGGCCAGGCACAGTGG - Intergenic
1164759999 19:30721501-30721523 GAATGACAGGCCAGGCACAGTGG - Intergenic
1165123360 19:33577716-33577738 GAATCAGAGGCCTCAGACAGAGG - Intergenic
1165303140 19:34985188-34985210 AATTCAGAGGCCAGGCACAGTGG - Intergenic
1165388585 19:35525969-35525991 GGAACAGAGGCCAGGTTCAGTGG - Intronic
1165403072 19:35614008-35614030 GAAAACGAGGCCAGAGTCAGCGG - Intronic
1165406880 19:35636540-35636562 GAAGCACAGGCCCAACTCAGAGG + Intronic
1165551598 19:36591430-36591452 GAAATTGAGGCCAGACGCAGTGG + Intronic
1165638319 19:37362749-37362771 ACATCAGAGGACACACTCAGGGG + Exonic
1165638398 19:37363337-37363359 GCACCAGAGGACACACTCAGGGG + Exonic
1165795801 19:38518483-38518505 GGATCAGAGGCCAGGGTAAGGGG + Intronic
1165989716 19:39803210-39803232 GAGACAGAGGCCTGACTCAGCGG + Intergenic
1166793679 19:45413561-45413583 GAACCAAAGACCAGACACAGTGG - Exonic
1166851882 19:45765223-45765245 GACTCAGGGTCCTGACTCAGGGG - Exonic
1166878388 19:45912165-45912187 GAAACAGAGGCCTGACGCAGTGG + Intergenic
1167232535 19:48294212-48294234 TGAACACAGGCCAGACTCAGTGG + Intergenic
1167406916 19:49316730-49316752 GAAGGATAGGCCAGACACAGTGG + Intronic
1167420873 19:49402417-49402439 GAATGAAAGGCCAGGCACAGTGG + Intronic
1167557274 19:50204048-50204070 GAATCGGAGGCCAGAGAGAGGGG + Intronic
1167619531 19:50553106-50553128 GAATCAGACCCCAGAATCAGAGG + Intronic
1168023868 19:53629527-53629549 AAATCATAGGCCGGACACAGTGG - Intergenic
1168081837 19:54015753-54015775 GAGAGAGAGGCCAGACGCAGTGG - Intergenic
1168099284 19:54132655-54132677 TAATAAGAGGCCAGACACAGCGG - Intergenic
1168188026 19:54713715-54713737 GAGTCTGAGGCCAGGCACAGTGG + Intergenic
1168555749 19:57338482-57338504 GAGTCAGAGGCCAGGCACGGTGG + Intergenic
1168561095 19:57383928-57383950 GAAGAAGTGGCCAGACACAGTGG + Intronic
925216133 2:2097211-2097233 GAATCAGAGGGGAGAAGCAGAGG - Intronic
925329758 2:3049317-3049339 GCATCAGGGGCCAGGCGCAGTGG + Intergenic
926163061 2:10501694-10501716 GACACAGAAGCCAGAATCAGAGG - Intergenic
926607920 2:14915845-14915867 CCATCAGAGGCCAGGCACAGTGG - Intergenic
927093497 2:19729932-19729954 GAATCAGAGGGAATACCCAGAGG - Intergenic
927206559 2:20614912-20614934 GAGTGAGAGGCCAGCCACAGAGG + Intronic
928437246 2:31262628-31262650 AAATTAGAGGCCAGGCACAGTGG + Intronic
928681851 2:33710850-33710872 GAATTAGAGGCCAGGCGCAGTGG + Intergenic
928923263 2:36548618-36548640 GAACCAGATGCAAGATTCAGTGG + Exonic
929180841 2:39036956-39036978 CAATCTGAGGCCAGGCGCAGTGG - Intronic
929613310 2:43288129-43288151 GAATCACAGGCCGGGCACAGTGG + Intronic
930106004 2:47640071-47640093 AAATTAGAGGCCAGGCACAGTGG - Intergenic
930155486 2:48103321-48103343 GATCCAGAGGCCGGGCTCAGTGG + Intergenic
930232553 2:48857793-48857815 AAATCTCAGTCCAGACTCAGGGG - Intergenic
930333413 2:50015574-50015596 TAAACAGAGGCCACACACAGAGG - Intronic
931092030 2:58896487-58896509 GGATGAGAGGCCTGACCCAGTGG + Intergenic
931295676 2:60922754-60922776 AACTCAGAGGCCAGGCGCAGGGG + Exonic
932573863 2:72952081-72952103 GCACCAGAGGCCTAACTCAGGGG - Intronic
932857256 2:75248773-75248795 GACTCACAGGCCAGGCACAGTGG - Intergenic
932924476 2:75956676-75956698 GAGTCAGAGGCCAGAATATGTGG - Intergenic
933601466 2:84336353-84336375 CAATGAGAGGCCAGACACGGTGG + Intergenic
933670120 2:84999130-84999152 AAATAAGAGGCCAGGCGCAGTGG - Intronic
933881542 2:86674696-86674718 GAATGTGAGGCCAGGCACAGTGG + Intronic
934670616 2:96209968-96209990 GATCCAGAGGCCAGCCTAAGCGG + Intergenic
934868792 2:97840435-97840457 GAGTAAGAGGCCAGGCACAGTGG + Intronic
935960296 2:108419104-108419126 GAATCAGAGGCCAGGCATGGTGG - Intergenic
936077584 2:109411526-109411548 GCAACAGAGACCAGATTCAGAGG + Intronic
936116530 2:109707326-109707348 GAAGCAGATGCCAGTCACAGAGG - Intergenic
936139611 2:109928143-109928165 GCATCAGAGGCCAGGCACGGTGG + Intergenic
936173945 2:110202389-110202411 TCATCACAGGCCTGACTCAGAGG + Intronic
936205085 2:110443343-110443365 GCATCAGAGGCCAGGCACGGTGG - Intronic
936820007 2:116509111-116509133 GAAGGAGAGGCCAGGCACAGTGG - Intergenic
936855037 2:116947606-116947628 GAATCATAGGCCGGGCGCAGTGG + Intergenic
937269614 2:120640330-120640352 AAATCAGGGGCCAGGCGCAGTGG - Intergenic
937281650 2:120721347-120721369 GAAACAGAGGCCCAACCCAGGGG - Intergenic
937556776 2:123167629-123167651 GAAACAGATGGCACACTCAGAGG - Intergenic
938075489 2:128331148-128331170 TAAAAAGAGGCCAGACACAGTGG - Intergenic
938124907 2:128664514-128664536 AAATCAGAGGCCACATGCAGAGG - Intergenic
938156272 2:128942967-128942989 GAATAAGAGCCAAGACTTAGTGG - Intergenic
938159322 2:128971552-128971574 AAATAAGAGGCCAGGCGCAGAGG - Intergenic
938596676 2:132794343-132794365 GAGACAGAGGCCAGGCACAGTGG + Intronic
938832605 2:135068025-135068047 GTAAGAGAGGCCAGGCTCAGTGG - Intronic
938991643 2:136635759-136635781 GAATGAGAGGCCAGAAACAGAGG - Intergenic
939590561 2:144059092-144059114 CAGTCAGAGGCCAGAATCTGAGG - Intronic
939726452 2:145726931-145726953 GATTCAGAGGCCAGCCCAAGTGG + Intergenic
939935399 2:148285844-148285866 GAATTAGAGGCCAGGCACAGTGG - Intronic
940161408 2:150717613-150717635 GAATTAGTGGCCAGGCGCAGTGG - Intergenic
940292379 2:152089924-152089946 AAAGCAGAGGCCAAACACAGAGG + Intronic
941042246 2:160635707-160635729 GAATCAAAGGGAACACTCAGAGG - Intergenic
941097198 2:161252202-161252224 GTATAAGAGGCCAGGCACAGTGG - Intergenic
941664881 2:168234863-168234885 GAGTCATAGGCCAGATGCAGTGG + Intronic
942295694 2:174515017-174515039 GAAGGAGAGGCCAGGCACAGTGG - Intergenic
942467532 2:176224423-176224445 TAAACTGAGGCCAGGCTCAGTGG + Intergenic
942648930 2:178146980-178147002 GACACAGAGACCAGACTGAGAGG - Intergenic
942752929 2:179308471-179308493 ACAACAGAGGCCAGGCTCAGTGG + Intergenic
942798684 2:179851161-179851183 GAAGTTGAGGCCAGACACAGTGG + Intronic
944578095 2:201109465-201109487 GAAATAGAGGCCAGGCACAGTGG - Intergenic
944758955 2:202793365-202793387 GAATAAGAGGCCGGGCACAGTGG + Intronic
944926511 2:204470769-204470791 GAATCAGAGGCCTTCCACAGTGG - Intergenic
945931351 2:215857816-215857838 AAAATAGAGGCCAGGCTCAGTGG - Intergenic
945956509 2:216091277-216091299 GACCCAGAGGCTAGGCTCAGTGG + Intronic
947134716 2:226965676-226965698 GAATTAGAGTTCAGTCTCAGAGG + Intronic
947152484 2:227129694-227129716 GTACCAGAGGCCAGGCGCAGTGG - Intronic
947163825 2:227241384-227241406 GTATTAGAGGCCAGACACAGTGG + Intronic
947473218 2:230416249-230416271 GGCTCAGAGGCCAGGCTCTGAGG + Exonic
947491824 2:230602238-230602260 GAATATGAGGCCAGGCACAGTGG + Intergenic
948093924 2:235318532-235318554 AAATTAGAGGCCAGGCGCAGTGG + Intergenic
1168774910 20:439320-439342 CAGTCAGAGGCCAGACACACAGG + Intronic
1168844348 20:933507-933529 GAGTCAGAGGCCCAACTCACAGG - Intergenic
1168914802 20:1476939-1476961 GAGTCAGATACCAGACTCAAGGG + Intronic
1169071912 20:2738017-2738039 GAACCAGAGCCCACAGTCAGGGG + Intronic
1169096054 20:2899817-2899839 AAATCTGAGGCCAGGCACAGTGG + Intronic
1169762218 20:9108284-9108306 GAAGCAAAGACAAGACTCAGAGG + Intronic
1170317536 20:15059108-15059130 GAATCCTGGGCCAGACGCAGTGG + Intronic
1170461218 20:16578163-16578185 AAATCGTAGGCCAGACGCAGTGG - Intergenic
1170634238 20:18091043-18091065 AAATCAGAGGCCAGGCACGGTGG + Intergenic
1170883356 20:20317159-20317181 GCATAAGAGGCCAGGCACAGTGG - Intronic
1171088790 20:22264758-22264780 GATTCTGATGCCAGACTCACTGG - Intergenic
1171279710 20:23885674-23885696 GAATCAGTGGCTAGAATCTGCGG + Intergenic
1171350344 20:24497486-24497508 GAAACCGAGGCCAGGCACAGTGG - Intronic
1172515754 20:35531750-35531772 GGATTTGAGGCCAGACTCAGTGG - Intergenic
1172557896 20:35858858-35858880 GAAACAGTGGCCAGACACAGTGG - Intronic
1172885567 20:38228609-38228631 CAATCAGAAGCCAGGCTCTGGGG - Intronic
1173440128 20:43068215-43068237 GAATTAGGGGCCAGGCGCAGTGG + Intronic
1173723636 20:45281365-45281387 TAATAAGGGGCCAGGCTCAGTGG + Intergenic
1174060842 20:47831857-47831879 GGATCAGAGGCCGCACTCACCGG + Intergenic
1174071056 20:47899513-47899535 GGATCAGAGGCCGCACTCACCGG - Intergenic
1174549530 20:51351949-51351971 GAATCAGGAGCCAGATGCAGTGG + Intergenic
1175897052 20:62342388-62342410 GTATCAGAGACCAGGCTCAGTGG + Intronic
1176197760 20:63845218-63845240 GAAGCAGAGGCCAGAAGCACAGG + Intergenic
1176377924 21:6095936-6095958 GAAGCAGAGTCCAGACTCTAAGG - Intergenic
1177518624 21:22187961-22187983 GAATGACAGGCCAGACACGGTGG - Intergenic
1177929768 21:27266561-27266583 GAAGCAGTGGCCAGAATCTGAGG + Intergenic
1178313123 21:31546262-31546284 AAACCAGAGGCCAGGCTCAGTGG + Intronic
1178376718 21:32073602-32073624 GGATGAGAGGCCAGAATCTGTGG - Intergenic
1179745550 21:43442312-43442334 GAAGCAGAGTCCAGACTCTAAGG + Intergenic
1179772804 21:43635950-43635972 GAATCATAGGCCAGGCACAGTGG + Intronic
1180452806 22:15482541-15482563 GAAACATAGGCAAAACTCAGTGG - Intergenic
1180929712 22:19580941-19580963 GAATCAGAGGCCAGGCGCGGTGG + Intergenic
1180933342 22:19608109-19608131 GAACCAGGGGGCAGACTCAGGGG + Intergenic
1181546791 22:23606810-23606832 GAATGAGAGGGCAGGCGCAGAGG - Intergenic
1181570727 22:23766737-23766759 GCAGCAGAGGCCAGGCGCAGTGG - Intronic
1181579457 22:23819628-23819650 AAAGCAGGGGCCAGACACAGGGG - Intronic
1181643991 22:24220462-24220484 GACACTGAGGCCAGACACAGTGG + Intronic
1181738231 22:24898645-24898667 GAACCAGAGGTCTGACTCCGGGG - Intronic
1181777012 22:25166976-25166998 GATTCAGAGGCCAGATGCTGGGG - Intronic
1181791743 22:25272916-25272938 GAATCAAAGGCCAGAATGAAAGG + Intergenic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1181983863 22:26785527-26785549 GAACCAGAGGTTAGACTCAAAGG - Intergenic
1182591843 22:31387117-31387139 GAACTAGAGGCTAGGCTCAGTGG - Intergenic
1183079071 22:35444724-35444746 GAGGCAGAGGCCAGGCACAGGGG + Intergenic
1183613645 22:38928025-38928047 GAATAAGAGGCCAGGCGCAGTGG + Intergenic
1183912157 22:41088032-41088054 GAAAAAGAGGCCAGGCTCGGTGG + Intergenic
1183933167 22:41247696-41247718 GAAACTGAGGCAAGACTCTGGGG + Intronic
1183952953 22:41362225-41362247 CAAGCAGAGGCCGGGCTCAGTGG + Intergenic
1184299936 22:43552116-43552138 GAATGAGAGGCCAGGCACAGCGG - Intronic
1184514983 22:44956309-44956331 GAGGCAGAGGCCCGACCCAGGGG + Intronic
1185040094 22:48499532-48499554 GAACCAGGGACCAGAGTCAGGGG - Intronic
1185188681 22:49418801-49418823 GCATCAGAGCCCGGACTCGGGGG + Intronic
949304536 3:2624918-2624940 GAATCAGAGGCCAGGCCCAGTGG - Intronic
950348278 3:12320538-12320560 GAAATATAGGCCAGACACAGTGG + Intronic
950385307 3:12654312-12654334 GTATGAGAGGCCAGGCACAGTGG + Intronic
950421884 3:12904212-12904234 GCATCACAGCACAGACTCAGGGG + Intronic
951266124 3:20569008-20569030 AAAGCAGAGGCCAGGCACAGTGG - Intergenic
952703988 3:36358160-36358182 GAATCATAGGCCAGGTACAGTGG - Intergenic
952813057 3:37422393-37422415 GAATCAGAGGTGAGGCTCTGTGG - Intronic
952863810 3:37837610-37837632 GAATAAGGGGCCAGGCACAGTGG - Intergenic
952888316 3:38025039-38025061 GAAGGAGGGGCCAGGCTCAGAGG + Intronic
953391820 3:42538338-42538360 TCCTCAGAGGCCAGAGTCAGGGG + Intergenic
953400273 3:42608255-42608277 GACTCAGAAGCCAGGCGCAGTGG - Intronic
954072089 3:48150453-48150475 GAATCAGAGGGCAGATGCATTGG + Intergenic
954100805 3:48371099-48371121 GGAACAGAGGCCAGGCACAGTGG - Intergenic
954183861 3:48901983-48902005 GAATGAGGGGCCAGGCGCAGTGG + Intergenic
954470578 3:50690926-50690948 GAAGTAGAGGCCAGGCACAGTGG - Intronic
954588670 3:51760664-51760686 GAAAGAGAGGCCAGGCGCAGTGG - Intergenic
954650011 3:52155257-52155279 GAAGGAGAGGCCGGGCTCAGTGG + Intergenic
955372344 3:58363607-58363629 AATTCTTAGGCCAGACTCAGCGG - Intronic
956193655 3:66631145-66631167 GAAGCAGAGGCCAGGCACAGTGG - Intergenic
956493201 3:69796266-69796288 GCAACAGAGGCCAGGCGCAGTGG - Intronic
956498011 3:69849662-69849684 GTATCAGAGCCCAGGCTCTGGGG - Intronic
956703187 3:71976880-71976902 GAATCAGAGACCAGGTGCAGTGG + Intergenic
956753984 3:72367594-72367616 GCAGCAGAGGCTAGACGCAGTGG + Intergenic
956795700 3:72716596-72716618 GAGTAAGAGGCCAGGCGCAGTGG - Intergenic
957514963 3:81238142-81238164 AAATCAGAAGCCAGTCTTAGTGG + Intergenic
957684969 3:83491272-83491294 TATTCAGAGGCCAGACACGGTGG + Intergenic
958600851 3:96294836-96294858 CAATCAGAGGCTAGACTCTGAGG - Intergenic
958856833 3:99395436-99395458 GGCTCATAGGCCAAACTCAGAGG - Intergenic
959341615 3:105138595-105138617 GAATGTGAGGCCAGGCGCAGTGG + Intergenic
960638867 3:119809156-119809178 GAATCAGAGGCCAGAGCCAAGGG + Intronic
960840075 3:121948734-121948756 AAATCATAGGCCAGATGCAGTGG - Intergenic
961030639 3:123600405-123600427 AAAAAAGAGGCCAGACACAGTGG - Intergenic
961771795 3:129255462-129255484 GAAAGAGAGGCCAGGCACAGTGG - Intronic
962356094 3:134695473-134695495 GCATCAGAGACCCGACTCACAGG + Intronic
962575112 3:136749257-136749279 GAGTCAGAGGTCAGACACACAGG + Intronic
962872981 3:139514256-139514278 GATTCAGAGGCCAGGCGCGGTGG + Intergenic
964821895 3:160779817-160779839 GTAGCAGAGGCCGGACGCAGTGG - Intronic
965001433 3:162959148-162959170 TAGTCAGAGGACAGACTCAGTGG + Intergenic
965258715 3:166451597-166451619 GAATCACTGGCCAGGCGCAGTGG + Intergenic
966178519 3:177166097-177166119 GGATCATAGGCCAGGCACAGTGG + Intronic
967312767 3:188121665-188121687 GAGTTAGAGGCCAGGCACAGTGG - Intergenic
968022033 3:195400905-195400927 GAATCAGAGGCCAGGCGAGGTGG + Intronic
968342974 3:197973535-197973557 CCATCAGAGGCCAGACACGGTGG - Intronic
968776944 4:2547910-2547932 TATTAAGAGGCCAGGCTCAGTGG - Intronic
969717294 4:8873901-8873923 GAATTAGAACTCAGACTCAGAGG - Intergenic
969934937 4:10671096-10671118 GAATTTGAGGCCAGATGCAGTGG + Intronic
970807967 4:20058049-20058071 GCCTCACAGGCCAGACGCAGTGG + Intergenic
971336430 4:25727793-25727815 GGATGGGAGGCCAGAGTCAGAGG + Intergenic
972247120 4:37256946-37256968 AAATCAGAGCCCAGATTCAAGGG - Intronic
972430340 4:38975662-38975684 AAATCACAGGCCAGGCGCAGTGG - Intronic
972552911 4:40149605-40149627 GAAAAAGAGGCCAGGCTCAGTGG + Intronic
972745747 4:41931000-41931022 GCAACAGAGGCCAGGCACAGCGG + Intergenic
974446118 4:61984417-61984439 CCATCAGTGGCCAGACACAGTGG + Intronic
974865664 4:67577934-67577956 AAATCAGAGGCCGGGCACAGTGG - Intronic
975365411 4:73522887-73522909 AAATAAGAGGCCAGACACGGTGG - Intergenic
975423408 4:74196659-74196681 TATTCAGTGGCCAGGCTCAGTGG + Intronic
975594042 4:76030341-76030363 GAAGCTGAGGCCAGACACGGTGG - Intronic
975764013 4:77648330-77648352 AAATAAGAGGCCAGGCGCAGTGG + Intergenic
977543313 4:98345118-98345140 CACTCAAAGGCCAGAATCAGTGG - Intronic
977799658 4:101211720-101211742 AAATCACAGGCCAGTCTGAGAGG - Intronic
977890525 4:102305838-102305860 GAATCAGAGGAGAGACTAATGGG + Intronic
978290771 4:107136975-107136997 AAATAGGAGGCCAGACACAGTGG - Intronic
978791308 4:112666045-112666067 GCAACAGAGGCCGGACACAGTGG + Intergenic
978813700 4:112878908-112878930 GAATCAGGGGCCGGGCGCAGTGG - Intronic
979247196 4:118520875-118520897 CAATCAGGGGCCAGGCGCAGTGG - Intergenic
980487546 4:133478832-133478854 GATTCAGAGGCCAGGCACAGTGG + Intergenic
981205342 4:142033952-142033974 GAAGTAGAGGCCAGGCACAGTGG - Intronic
981709836 4:147698283-147698305 AAAACAGAGGCCGGGCTCAGTGG + Intergenic
981770850 4:148305966-148305988 GATTCTGAGGACAGACTCATGGG + Intronic
984872796 4:184342101-184342123 GTTCCAGAGGCCAGACTCAAGGG - Intergenic
985320665 4:188707484-188707506 GTATCAGAAGCCAGACTGATAGG - Intergenic
985530575 5:431557-431579 GAATCAGAGCCCTGAGGCAGTGG + Intronic
985708013 5:1412781-1412803 TAATCAAAGGCCAGAGCCAGGGG + Intronic
985797131 5:1971575-1971597 GAATCTGAGGCCCGGCGCAGTGG + Intergenic
986237280 5:5923460-5923482 GAAACAGAGGCCAGGCGCGGTGG - Intergenic
988003111 5:25374960-25374982 GAAGCAGAGGTCAGATTGAGGGG + Intergenic
988507595 5:31837433-31837455 GAATATGAGGCCAGGCACAGTGG + Intronic
988576378 5:32429271-32429293 GAAGAAGAGGCCAGACGCAGTGG - Intronic
989243574 5:39228060-39228082 GAATAAGATGAAAGACTCAGAGG + Intronic
989424342 5:41278567-41278589 GAATCTCAGACCAGACACAGGGG + Intergenic
989627967 5:43450277-43450299 AAATCAAAGGCCAGGCGCAGTGG - Intronic
990434890 5:55779434-55779456 GACTCATAGGGCAGACTCATAGG - Intronic
990592002 5:57275609-57275631 GAAGAAGAGGCCAGACACAGTGG - Intergenic
991234478 5:64377983-64378005 TAACCAGAGGCCGGGCTCAGTGG - Intergenic
991734357 5:69617902-69617924 AAATAATAGGCCAGACGCAGTGG - Intergenic
991780622 5:70128823-70128845 AAATAATAGGCCAGACGCAGTGG + Intergenic
991810790 5:70473037-70473059 AAATAATAGGCCAGACGCAGTGG - Intergenic
991859910 5:71004246-71004268 AAATAATAGGCCAGACGCAGTGG + Intronic
991873070 5:71129142-71129164 AAATAATAGGCCAGACGCAGTGG + Intergenic
992582512 5:78195530-78195552 GAGTCACAGGCCAGGCGCAGCGG + Intronic
993719173 5:91305197-91305219 GAATAATAGGCCAGGCTCGGTGG - Intergenic
994080388 5:95702586-95702608 TAGTCAGAGGCCAGGCACAGTGG + Intergenic
994477170 5:100286094-100286116 GAATATTAGGCCAGGCTCAGTGG - Intergenic
995096609 5:108242507-108242529 GAGTTATAGGCCAGACACAGTGG - Intronic
995201418 5:109429045-109429067 GAATCAGAAGTTAGATTCAGAGG - Intergenic
995313519 5:110739553-110739575 GAAGAGGAGGCCAGCCTCAGGGG - Intronic
996054329 5:118966740-118966762 CAATCAGAGGCCAGGCACAGTGG + Intronic
997615817 5:135245582-135245604 GCATCAGAGGCCAGCCCCAGTGG + Intronic
997733608 5:136197848-136197870 GGATCAGTTGCCAGGCTCAGGGG + Intergenic
997927660 5:138045709-138045731 CAAACAGTGGCCAGACACAGTGG + Intronic
998516021 5:142755093-142755115 AAAAAAGAGGCCAGACGCAGTGG - Intergenic
999179971 5:149662671-149662693 AAAAAAGAGGCCAGGCTCAGTGG + Intergenic
999219629 5:149963868-149963890 AAAACAGAGGCCAGGCACAGTGG - Intronic
999248694 5:150168718-150168740 GAATTAGAGCACAGACTTAGTGG - Intronic
999957490 5:156718490-156718512 GGATAATAGGCCAGGCTCAGTGG + Intronic
1000189163 5:158892199-158892221 AAATCTGAGGCCAGGCACAGTGG + Intronic
1001670769 5:173471865-173471887 GAAACACAGGCCAGGCACAGTGG + Intergenic
1001976666 5:176006032-176006054 GAATCAGATTGCAGAATCAGAGG - Intronic
1002776910 6:336191-336213 GAATCAGAGGCCAGACTCAGTGG - Intronic
1003260191 6:4509917-4509939 AAAACAGAGGCCAGGCACAGTGG + Intergenic
1003358179 6:5395336-5395358 CAATCAGTGGCCAGGCACAGTGG - Intronic
1004037976 6:11942878-11942900 GAATAAGGGGCCAGGCGCAGTGG + Intergenic
1004577825 6:16915240-16915262 GGAACAGAGGCCAGACGCAGTGG - Intergenic
1004998357 6:21216001-21216023 GAATCAGAGGTCAGAGTGATAGG + Intronic
1005319026 6:24633470-24633492 GAATTAAGGGCCAGGCTCAGTGG + Intronic
1005470861 6:26160918-26160940 GAAAAAGAGGCCAGGCACAGTGG + Intronic
1005960910 6:30692477-30692499 GTGTAAGAGGCCAGACTCGGTGG + Intergenic
1005968150 6:30742082-30742104 GGGGCAGAGGCCAGACTCACAGG + Intronic
1006014938 6:31073062-31073084 GAATTAAAGGCCAGGCACAGTGG + Intergenic
1006507745 6:34501229-34501251 AAATTGGAGGCCAGCCTCAGTGG - Intronic
1007259695 6:40555060-40555082 GGAAAAGAGGTCAGACTCAGGGG - Intronic
1007490806 6:42220485-42220507 TAAACAGAGGCCAGCCTGAGGGG - Intergenic
1007681015 6:43633457-43633479 CAATTAGAGGCCAGGCACAGTGG - Intronic
1008111596 6:47501032-47501054 AAAACACAGGCCAGGCTCAGTGG - Intronic
1008512622 6:52291062-52291084 GAAGCTGGGGCCAGGCTCAGTGG + Intergenic
1008631566 6:53366947-53366969 GAAGCAGGGGCCAGGCACAGTGG - Intergenic
1009351591 6:62686612-62686634 TAATCTGAGGCCACACTGAGTGG + Intergenic
1009598332 6:65764888-65764910 GAAACAGAGGCCAGGCACGGTGG - Intergenic
1010018484 6:71132119-71132141 AAAACAGAGGCCAGGCACAGTGG - Intergenic
1010185957 6:73143465-73143487 GAATGAGAGGCAAGAAGCAGCGG - Intronic
1010208152 6:73341610-73341632 GAATGCTAGGCCAGACTCAGAGG + Intergenic
1010231906 6:73542221-73542243 GAATCAAAAGCCAGGCGCAGTGG - Intergenic
1010275847 6:73967538-73967560 GAATCAGAGACCAGAGGCAATGG - Intergenic
1013250281 6:108326670-108326692 GAATGAGGGGCCAGACGCAGTGG + Intronic
1013295496 6:108754926-108754948 GAATCACAGGCCAGATGCAGTGG + Intergenic
1015155518 6:130090872-130090894 AAATTTGAGGCCAGGCTCAGTGG - Intronic
1015516181 6:134084852-134084874 GAATTGGAGGCCGGACGCAGTGG + Intergenic
1016050422 6:139524652-139524674 AAATCCGAGGCCAGGCGCAGCGG - Intergenic
1016112927 6:140248360-140248382 GAAGTAGAGGCCAGGCGCAGTGG - Intergenic
1016403799 6:143709083-143709105 GAACCAGAGGGCAAACCCAGGGG - Intronic
1016601809 6:145870547-145870569 AAATCTGAGGCCAGGCGCAGTGG - Intronic
1016931867 6:149419304-149419326 TAAACAGAGGCCAGGCGCAGTGG - Intergenic
1017357280 6:153524469-153524491 GACTCAGAGGCCATATTCTGGGG - Intergenic
1017403981 6:154096345-154096367 GCGTTAGAGGCCAGACACAGGGG - Intronic
1017846430 6:158262409-158262431 GAATCAGAGGTCAGTTTCAGAGG + Intronic
1017963959 6:159247459-159247481 GGATCAGAGGCCGGCCGCAGTGG + Intronic
1018357577 6:163034556-163034578 GAATTAGAGGCCCAACTTAGGGG - Intronic
1018667720 6:166154898-166154920 GGATCAGAGGCTAGGATCAGTGG + Intergenic
1018668507 6:166161378-166161400 CAACCAGAGGCTAGACTCTGAGG - Intronic
1018740418 6:166723985-166724007 GACTCAGGGGCCAGGCACAGTGG - Intronic
1018801588 6:167226958-167226980 GATCCAGAGGCCAGACCAAGCGG + Intergenic
1020316744 7:6910884-6910906 GAAGCAGAGGCCAGGCGCTGTGG - Intergenic
1020740374 7:12008881-12008903 GAATAAGAGGCCAGTCTTAGAGG + Intergenic
1020848279 7:13315106-13315128 TAAGCAGAGGCCAGGCACAGTGG - Intergenic
1020895838 7:13938230-13938252 GAAACATAGGCCAGACGCAGTGG - Intronic
1021221441 7:17979280-17979302 AAGTCTGAGGCCAGACGCAGAGG - Intergenic
1021692280 7:23242255-23242277 GAATCACAGGCCAGGTGCAGTGG - Intronic
1022009848 7:26299469-26299491 AAATCAGAGGCCAGGCACAGTGG - Intronic
1022071133 7:26915435-26915457 AAATCTGAGGCCAGGCGCAGTGG - Intronic
1022332886 7:29396956-29396978 GAGGCAGAGCCCAGTCTCAGGGG - Intronic
1022535236 7:31094388-31094410 GAAACTGAGGCCAGACACAAGGG - Intronic
1023512571 7:40968984-40969006 GAATAAGAGGACAGCCTCAGGGG - Intergenic
1023634381 7:42195052-42195074 GCATTAGAGGCCAGGCACAGTGG - Intronic
1024169359 7:46768288-46768310 GATTCAGAGGCCAGCCCAAGAGG + Intergenic
1024321429 7:48075167-48075189 GACTCAGAGGCCAGGTGCAGTGG + Intergenic
1024323904 7:48093870-48093892 GAGGCAGAGGCCAGGCGCAGTGG + Intronic
1025723096 7:64034246-64034268 GTATCAGATGCCAGGCGCAGTGG + Intronic
1025851282 7:65246791-65246813 AAAGCAGAGGCCAGGCACAGTGG + Intergenic
1026169904 7:67944815-67944837 TAAACAAAGGCCAGGCTCAGTGG - Intergenic
1026198110 7:68190422-68190444 GAAGAAGAGGCCAGTCGCAGTGG + Intergenic
1026356125 7:69558994-69559016 AAAACAGAGGCCAGACCCAGTGG - Intergenic
1026922591 7:74167064-74167086 GAATTGTAGGCCAGGCTCAGTGG - Intergenic
1026934472 7:74245305-74245327 GAATCTGAGTCCAGGCTCGGTGG - Intronic
1027111546 7:75443650-75443672 AAAAAAGAGGCCAGACGCAGTGG + Intronic
1027283777 7:76628183-76628205 AAAAAAGAGGCCAGACGCAGTGG + Intergenic
1027613698 7:80394485-80394507 GAATAACAGGCCAGGCGCAGTGG + Intronic
1028151162 7:87374073-87374095 GAAGCAGAAGCCAGACTGTGTGG + Intronic
1029231946 7:99077617-99077639 GATTAAGAGGCCAGGCGCAGTGG - Intronic
1029306531 7:99624000-99624022 GAATCCTAGGCCAGAGACAGTGG - Intronic
1029480771 7:100811580-100811602 GAATGACAGGCCAGGCACAGTGG + Intronic
1029593722 7:101525466-101525488 AAGTCAGAGGCCAGGCTCAGTGG - Intronic
1030702772 7:112659604-112659626 GAACCAGAGGCGAGGCGCAGTGG - Intergenic
1031332604 7:120484440-120484462 AAATCAGAGGCCAGGAACAGAGG - Intronic
1032003411 7:128281537-128281559 GAATATGAGGCCAGACTCAGTGG - Intergenic
1032163157 7:129526040-129526062 GAGTTAGAGGCCAGGCACAGTGG + Intergenic
1032348086 7:131135405-131135427 GGAAGAGAGGCCAGACGCAGTGG - Intronic
1032412287 7:131704959-131704981 GGATTAGAGGCCAGGCACAGTGG + Intergenic
1032491642 7:132328517-132328539 GAATCAGATGTAAGAATCAGAGG + Intronic
1032667466 7:134051331-134051353 GAATCAGAGAAGAAACTCAGAGG + Intronic
1033049190 7:137988804-137988826 CCCTCAGAGGCCAGGCTCAGTGG + Intronic
1033056463 7:138059474-138059496 GAATCCTGGGCCAGACACAGCGG + Intronic
1033115008 7:138617559-138617581 GTAACTGAGGCCAGGCTCAGCGG + Intronic
1033204775 7:139409151-139409173 AGATCATAGGCCAGTCTCAGTGG + Intronic
1033428769 7:141269380-141269402 GAAACAAAGGCCAGGCACAGTGG - Intronic
1033664623 7:143428798-143428820 GAATCAGAGGCCGGGCGCGGTGG - Intergenic
1034537541 7:151735141-151735163 GAATCAGAGGCCGGGCGCGGTGG - Intronic
1034622973 7:152470649-152470671 GAAACAGAGGCCAGGCACAGTGG + Intergenic
1035203005 7:157278846-157278868 GAAGCAGAGGGCAGGCTCACAGG - Intergenic
1035447065 7:158950350-158950372 GAATCTTAGGCCAGGCACAGTGG - Intronic
1036511236 8:9402333-9402355 GAATCAGATGCCAGACCTTGAGG - Intergenic
1036670515 8:10782446-10782468 TACTCAGAGGCCAGGCGCAGTGG + Intronic
1036926995 8:12916542-12916564 AAATCATAGGCCAATCTCAGTGG + Intergenic
1037360048 8:18063604-18063626 AAATTAGAGGCCAGGCACAGTGG - Intronic
1037388640 8:18369000-18369022 GAATTACAGGCCAGGCACAGTGG + Intergenic
1037782541 8:21880289-21880311 GAATCTGAGGCCAGGCACAGTGG + Intergenic
1037999842 8:23382228-23382250 CAATCAGCGGCCAGGCACAGTGG + Intronic
1038103658 8:24409238-24409260 CAAACAGAGGCCAGGCACAGTGG + Intergenic
1038180246 8:25220889-25220911 GAATGAGAGGCCAGGCGCAGTGG - Intronic
1038462598 8:27729501-27729523 GGAGCAGAGGCCAGGCACAGTGG + Intergenic
1038837843 8:31148171-31148193 GAAAAAGAGGCCAGGCACAGTGG - Intronic
1038913332 8:31992045-31992067 GAAAATGAGGCCAGGCTCAGTGG + Intronic
1040746600 8:50650986-50651008 AAATGAGAGGCCAGGCGCAGTGG - Intronic
1040824027 8:51597999-51598021 CAATCCTAGGCCAGACGCAGTGG - Intronic
1041419342 8:57648790-57648812 GAAACAGATGACACACTCAGTGG + Intergenic
1042041810 8:64599473-64599495 CAATCAGCGGCCGGACACAGTGG - Intronic
1042598519 8:70474714-70474736 GAAACACAAGCCAGACACAGTGG + Intergenic
1043736676 8:83756847-83756869 AAATGAGAGGCCAGACGCAGTGG + Intergenic
1044189375 8:89296912-89296934 GAATAATAGGCCAGCCGCAGTGG + Intergenic
1044594596 8:93946315-93946337 AAATCATTGGCCAGGCTCAGTGG - Intergenic
1045284008 8:100774119-100774141 GCAACAGAGGCCAGGCGCAGTGG - Intergenic
1045651593 8:104346466-104346488 GAATCAGAGGCTGGACTGAAGGG - Intronic
1045729562 8:105220225-105220247 GGCTCAGAGGCCAGGCGCAGGGG + Intronic
1046205497 8:110990162-110990184 GAATTAGAAACCAGACTCATTGG - Intergenic
1046861097 8:119092616-119092638 GAATTAGAGGCCGGATGCAGTGG + Intronic
1047703252 8:127471652-127471674 GAATCATTGGCCAGACGTAGTGG + Intergenic
1047917753 8:129600967-129600989 AAATACAAGGCCAGACTCAGTGG - Intergenic
1047991479 8:130291064-130291086 GCAGCAGAGGCAAGCCTCAGGGG - Intronic
1048447894 8:134505613-134505635 GAAACAGAGGTCAGAGTGAGTGG + Intronic
1048610457 8:136016663-136016685 GAATCAGAGGCCGGGGGCAGTGG + Intergenic
1049841000 8:144771836-144771858 GTAACAGAGGCCAGGCACAGTGG + Intergenic
1049962095 9:746748-746770 GAATTTGAGGCCAGATGCAGTGG - Intergenic
1050106855 9:2174630-2174652 GAAGCAAAGGCCAGGCACAGTGG + Intronic
1050478835 9:6068763-6068785 GGATCAGAGGCCAGACTCTGAGG - Intergenic
1050828553 9:9981645-9981667 GAATCGTTGGCCAGACGCAGTGG - Intronic
1051010576 9:12408344-12408366 GAAGAAAAGGCCAGGCTCAGAGG - Intergenic
1052226623 9:26096633-26096655 GAATCTGAGGCCAGAGTCTTAGG - Intergenic
1052961160 9:34298255-34298277 GAAACAGAGGCCGGGCGCAGTGG + Intronic
1053364005 9:37510047-37510069 AAATCTGAGGCCAGGCACAGTGG + Intergenic
1053376356 9:37609872-37609894 GAATCAGAGCCAAGACTCTGGGG - Intronic
1053398623 9:37798793-37798815 GAATCAAGGGCCAGACACAGTGG - Intronic
1053400037 9:37810747-37810769 CATTCAGAGGCCAGGCGCAGTGG - Intronic
1054769289 9:69069074-69069096 GAAGAAGGGGCCAGACACAGTGG + Intronic
1055707241 9:79018931-79018953 GAATCAGAGGTGAGGCTGAGAGG + Intergenic
1056175425 9:84030036-84030058 GAATTATAGGCCAGGCTCGGTGG - Intergenic
1056244227 9:84678327-84678349 GAATCAGAAGATAGACACAGTGG - Intronic
1056488486 9:87082742-87082764 GCATTAGAGGCCAGCCTGAGAGG - Intergenic
1057012258 9:91615242-91615264 GAACCAGAGGCCAGGCGCAATGG + Intronic
1057074682 9:92132012-92132034 CAAGCAGAGGCCAGGCACAGTGG - Intergenic
1057084615 9:92197592-92197614 CAAGCAGAGGCCAGGCACAGTGG + Intergenic
1057156959 9:92850882-92850904 GAACCATAGGCCAGACACGGTGG - Intronic
1057749351 9:97779271-97779293 GAAGCAGAGGCTGGACACAGTGG + Intergenic
1057802910 9:98200726-98200748 AAATGACAGGCCAGACACAGTGG + Intronic
1057947633 9:99343634-99343656 GAATATGAGGCCGGGCTCAGTGG + Intergenic
1058568133 9:106309276-106309298 AAATCATAGGCCAGGCGCAGTGG + Intergenic
1059146666 9:111905739-111905761 GAAGGAGAGGCCGGGCTCAGTGG - Intronic
1059161210 9:112036674-112036696 TTAACAGAGGCCAGGCTCAGTGG - Intergenic
1059229274 9:112703429-112703451 GAACCAGAGGCCAGACATGGTGG + Intronic
1059636036 9:116171595-116171617 GAATCAGAGGCATGTTTCAGAGG - Intronic
1059969923 9:119656228-119656250 GACTTAGAGCCCAGACTTAGAGG - Intergenic
1060917686 9:127400805-127400827 GCTTTAGAGGCCAGACCCAGTGG + Intronic
1061092903 9:128436666-128436688 GACACAGAGGCCAGGCACAGTGG - Intronic
1061188914 9:129070628-129070650 GAAGCAGAGGCCAGGACCAGTGG + Exonic
1061536487 9:131253388-131253410 CAGGCATAGGCCAGACTCAGTGG - Intergenic
1061558932 9:131390198-131390220 CAAACACAGGCCAGACGCAGTGG - Intergenic
1061584876 9:131559065-131559087 GAATCTGATGCCAGAGTCATAGG - Intergenic
1061611437 9:131749291-131749313 GAATGAGAGGCTGGACGCAGTGG - Intergenic
1062191322 9:135249339-135249361 GAAGCAGGGGCCAGACACAGTGG - Intergenic
1203664955 Un_KI270754v1:15760-15782 GGAACAGAGGCGAAACTCAGGGG + Intergenic
1185447014 X:263748-263770 GAATCAGGGGCCGGACGCGGTGG + Intergenic
1185782574 X:2862114-2862136 GAAGCAGAGGCCAGAGAGAGAGG + Intronic
1185804652 X:3046171-3046193 AAACCAGAGGCCAGGCGCAGTGG - Intronic
1185887028 X:3792147-3792169 GAATCGGAGGCCAGACACAGTGG - Intergenic
1186864391 X:13704905-13704927 GAATAAGGGGCCAGGCACAGTGG - Intronic
1187898793 X:24008524-24008546 GAATTAGTGGCCAGGCGCAGTGG - Intronic
1187952925 X:24488399-24488421 CAAACAGAGGCCAGGCGCAGTGG + Intronic
1187962121 X:24576590-24576612 GAAACACAGGCCAGGCACAGTGG - Intronic
1188077272 X:25793863-25793885 TAATCAGAGGCCAGGCGCAGTGG + Intergenic
1188402111 X:29758403-29758425 GAAATACAGGCCAGACGCAGTGG + Intronic
1189393402 X:40597823-40597845 GAATGGGAGGCCAGATGCAGTGG - Intronic
1189686840 X:43573324-43573346 GAAACAGCGGCCAGGCGCAGCGG - Intergenic
1190046959 X:47119931-47119953 TAATCCTAGGCCAGACACAGCGG + Intergenic
1190168639 X:48093945-48093967 ATATCAGAGGCCAGGCGCAGTGG + Intergenic
1190169175 X:48098184-48098206 TAATAAGAGGCCGGGCTCAGTGG - Intergenic
1190794614 X:53729312-53729334 GGATCATAGACCAGACGCAGTGG + Intergenic
1190815110 X:53922998-53923020 TAAACAGAGGCCAGGCGCAGTGG + Intergenic
1192281849 X:69695950-69695972 AGATCAAAGGCCAGACGCAGTGG + Intronic
1193947952 X:87762411-87762433 GAAAAAGAGGCCAGGCACAGTGG - Intergenic
1194149242 X:90302656-90302678 TAAACATAGGCCAGACACAGTGG - Intergenic
1194820767 X:98504317-98504339 GAATTATAGGCCAGCCACAGTGG + Intergenic
1195902041 X:109809334-109809356 GACACAGAGGCCAGGCGCAGTGG + Intergenic
1196726284 X:118898763-118898785 AAATCAGGGGCCAGACACAGTGG - Intergenic
1197272325 X:124438213-124438235 CAGTCAGAGGCCAGGCACAGTGG - Intronic
1197752073 X:129971628-129971650 GAATCATAGGCCAGGCACAGTGG - Intergenic
1198211018 X:134516360-134516382 GAAAGAGAGGCCGGACTCAGTGG + Intronic
1198942658 X:141974735-141974757 GAGTCAGGGGCCAGACTGTGTGG + Intergenic
1199209234 X:145187387-145187409 GAAGAAGAGGCCAGGCGCAGTGG + Intergenic
1199237087 X:145504553-145504575 TAATCAGAGGCCGGGCGCAGTGG + Intergenic
1200297090 X:154931162-154931184 TAATTGGAGGCCTGACTCAGGGG + Exonic
1200360523 X:155601001-155601023 GCATCAGAGGCCACACCCTGTGG + Intronic
1200694280 Y:6344545-6344567 AAATGATATGCCAGACTCAGTGG - Intergenic
1200828739 Y:7669428-7669450 AAATGACATGCCAGACTCAGAGG + Intergenic
1200885326 Y:8262141-8262163 AAATGACATGCCAGACTCAGTGG + Intergenic
1200986101 Y:9304508-9304530 GAAGAAGAGGACAGACTCAAAGG - Intergenic
1201040997 Y:9830171-9830193 AAATGATATGCCAGACTCAGTGG + Intergenic
1201262505 Y:12174025-12174047 AAATAAGAGGCCAGGCACAGTGG + Intergenic
1201504153 Y:14679294-14679316 ATTTCAGAGGCCAGACGCAGTGG - Intronic
1201569891 Y:15402579-15402601 TAATCAAAGGACAGACTCATTGG + Intergenic
1201733758 Y:17234905-17234927 AAAGTTGAGGCCAGACTCAGTGG - Intergenic
1202124483 Y:21556394-21556416 GAAGAAGAGGACAGACTCAAAGG + Intergenic
1202154525 Y:21872986-21873008 GAAGAAGAGGACAGACTCAAAGG - Intergenic
1202232526 Y:22671168-22671190 GAAGAAGAGGACAGACTCAAAGG + Intergenic
1202310630 Y:23524990-23525012 GAAGAAGAGGACAGACTCAAAGG - Intergenic
1202560172 Y:26145604-26145626 GAAGAAGAGGACAGACTCAAAGG + Intergenic