ID: 1002778500

View in Genome Browser
Species Human (GRCh38)
Location 6:348838-348860
Sequence CTGGGTAAATATAAGGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002778494_1002778500 11 Left 1002778494 6:348804-348826 CCCTTTGCAGGATGCAGAAGAAG 0: 1
1: 0
2: 5
3: 43
4: 500
Right 1002778500 6:348838-348860 CTGGGTAAATATAAGGAGCAAGG 0: 1
1: 0
2: 3
3: 14
4: 172
1002778495_1002778500 10 Left 1002778495 6:348805-348827 CCTTTGCAGGATGCAGAAGAAGC 0: 1
1: 0
2: 0
3: 28
4: 254
Right 1002778500 6:348838-348860 CTGGGTAAATATAAGGAGCAAGG 0: 1
1: 0
2: 3
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002778500 Original CRISPR CTGGGTAAATATAAGGAGCA AGG Exonic
900005599 1:47149-47171 CTGACTAAATATAAGGGACATGG - Intergenic
901178159 1:7319963-7319985 CTGGGTAAATAAATTTAGCAAGG - Intronic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
906775513 1:48525913-48525935 GTGGGTTAATAGAAGGAGCTGGG + Intergenic
906928002 1:50139656-50139678 TTGGGTAGATAAAAGGAGCCTGG + Intronic
910149731 1:84127331-84127353 ATAGGTAATTTTAAGGAGCAGGG - Intronic
910310533 1:85819074-85819096 ATGGGGAGATATAAGGATCATGG + Intronic
913093640 1:115496633-115496655 CTGAGTTTATACAAGGAGCAAGG - Intergenic
914850522 1:151310606-151310628 GTGGGTAAAAAAAAAGAGCAGGG - Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
916554467 1:165882140-165882162 CTGGGTAAATATCTGGAGGTCGG + Intronic
917861068 1:179144561-179144583 CTAGGTCAATATAAGTAACAGGG + Intronic
918041763 1:180917956-180917978 CTGAGTAAATAGAGGGACCATGG - Intronic
918331740 1:183467614-183467636 CTTAGTAAATATTAGGAGAATGG + Intergenic
919406384 1:197189637-197189659 CTGGGTAGATTTAAAGAGAAGGG - Intronic
919487577 1:198163007-198163029 CTAGGTAAATATAAGGATATAGG - Intronic
922022573 1:221719278-221719300 TTTGGTGAATATAATGAGCAAGG + Intronic
923031316 1:230251069-230251091 CTGGGTAAAAATAATTTGCATGG - Intronic
923292124 1:232556251-232556273 TTGGGTAAATTTGAGGGGCAGGG - Intronic
923513252 1:234672029-234672051 CTGGGTAATTGTATAGAGCAGGG - Intergenic
1065666671 10:28070706-28070728 CTGGACATATATAAGGAGCAAGG + Intronic
1066616416 10:37299539-37299561 CTGGGCAAGTTTGAGGAGCATGG - Intronic
1068361584 10:55980642-55980664 CAGGGTAAAAATAAACAGCAAGG + Intergenic
1068815108 10:61300858-61300880 CTGGGTGAATTTAAAGAGCATGG - Intergenic
1070165382 10:73893675-73893697 CAGGGAAAGTATAAGGAGCAAGG - Intergenic
1070283406 10:75066735-75066757 CTGGAGAGATGTAAGGAGCAGGG - Intergenic
1070740440 10:78899719-78899741 GTGGGAAAAAATAAGGTGCAGGG + Intergenic
1071503771 10:86221058-86221080 CTCAGAAAATATTAGGAGCAGGG - Intronic
1072926040 10:99618227-99618249 CTATGTAAATATATGGAGTAAGG + Intronic
1077754674 11:5014053-5014075 GTGTGTAAATATGAGAAGCACGG - Intergenic
1078750963 11:14163449-14163471 CTGGAGAAATAAAAGGAGAATGG - Intronic
1080182717 11:29443842-29443864 CTGGGTAAATATAAAGAAAAGGG + Intergenic
1081284391 11:41249379-41249401 CTAGGTAAAAGTAAGGAGAATGG - Intronic
1083230897 11:61318226-61318248 CTGAATAAATATAATGAGAAGGG - Intronic
1087498844 11:98925117-98925139 CTGGGTAAAAATCAGGACAAGGG - Intergenic
1089033424 11:115358317-115358339 CTGGGTAATTATAAAGAAAAAGG + Intronic
1089574347 11:119431034-119431056 TTGGATAAATATAAGGAGTAAGG + Intergenic
1092469837 12:8767827-8767849 CTGGTTAAAAATAATTAGCATGG - Intronic
1095192435 12:39272834-39272856 CTGGGTAAGTTTAATGCGCATGG - Intergenic
1095389681 12:41690522-41690544 ATGGGTAAACATAAGCAGAAAGG + Intergenic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1103423773 12:120813090-120813112 GAGGGTAAATATAAGGATAAGGG + Intronic
1107173846 13:37377263-37377285 TTAGGTAAATAGAAAGAGCAAGG - Intergenic
1107457372 13:40567204-40567226 TTGGTTAAATATAAAGACCAGGG - Intronic
1107961681 13:45564744-45564766 CTGTGAAAAAATAAGGACCAAGG + Intronic
1108158156 13:47609785-47609807 CTGGGTATATATAAAAAGAAAGG + Intergenic
1108521195 13:51248378-51248400 GTGGGTAAATAGAAGAGGCATGG - Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1111410500 13:87871021-87871043 TTGATTAAATATATGGAGCATGG + Intergenic
1111543600 13:89700767-89700789 GTGGGAAAATATAAGGAACAAGG + Intergenic
1111593024 13:90374133-90374155 CTGGGTAACTATAAAGAGGGAGG + Intergenic
1115557449 14:34554652-34554674 CTGGGTAAATACAAGGGGCAGGG + Intergenic
1115773004 14:36686185-36686207 GTGGCTAAATATAAAAAGCAAGG + Intronic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1116417433 14:44695813-44695835 CTGGGTAAATAACAGGATGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117096012 14:52298955-52298977 CTCGGAAAATATAAGAAGTAAGG + Intergenic
1119539579 14:75429107-75429129 CTGGGTCAGTAGGAGGAGCAGGG + Intronic
1124162171 15:27282382-27282404 CTGGGGAAATAAGAAGAGCAGGG - Intronic
1124815784 15:32990690-32990712 CTGGGTAATTATAAGGAAAGAGG + Intronic
1125206659 15:37161248-37161270 CTGCTTAACTATAAGGAGCTTGG + Intergenic
1129415111 15:75372143-75372165 CTGGGTAGATAAATGGACCAAGG - Exonic
1129615764 15:77097944-77097966 CTGGGAAAATAAATGGAACATGG - Intergenic
1132447917 15:101943773-101943795 CTGACTAAATATAAGGGACATGG + Intergenic
1135290072 16:21228728-21228750 ATGGGGAGATATGAGGAGCATGG + Intergenic
1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG + Intergenic
1138045166 16:53714872-53714894 CTGGGGCAATTTAAGCAGCAGGG - Intronic
1139960676 16:70715660-70715682 GTGGGTAAAAATAAGGAGCCCGG - Intronic
1140485073 16:75287287-75287309 CTGTGTTCATATAAGGTGCAAGG - Intergenic
1142853477 17:2716782-2716804 CTGCATAAAGATAAGGAGGAGGG + Intergenic
1144715228 17:17430465-17430487 ATGGGTAAATATAAGGTATAAGG + Intergenic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148889310 17:50796359-50796381 CTGGATAATTATGAGGAACAGGG + Intergenic
1149787643 17:59449677-59449699 CTGGGTAATTATAAAGAAAAAGG - Intergenic
1150054523 17:62001326-62001348 CTGGGAAATTAGAAGTAGCAGGG - Intronic
1150561539 17:66299636-66299658 TGGGGTAAGTTTAAGGAGCAGGG - Intergenic
1151951688 17:77357805-77357827 CTGGGTGAATACAAGGAGTGAGG - Intronic
1157080509 18:44519867-44519889 CTGGGCAAAGAAAATGAGCACGG + Intergenic
1157173973 18:45433955-45433977 CTGAGTAAGTATTATGAGCATGG - Intronic
1158592872 18:58792158-58792180 CTGGGCACATATAAGAAGGAGGG - Intergenic
1160637354 19:88760-88782 CTGACTAAATATAAGGGACATGG - Intergenic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1161676518 19:5653434-5653456 CTGGCTAAATTAAAGGGGCAGGG + Intronic
1165756233 19:38294756-38294778 CTGGGTAAAGATCAGGACAAAGG + Intronic
1167374805 19:49104916-49104938 CTGGGTTACTGTGAGGAGCAGGG + Intronic
1168606592 19:57765149-57765171 CTGAGTAATCGTAAGGAGCATGG - Intergenic
927463933 2:23323182-23323204 CTGTGTAAAGCTAAGGAGCTCGG + Intergenic
928624026 2:33121000-33121022 CTGAGTAAATATAATTCGCATGG + Intronic
931250690 2:60528471-60528493 CTGGGCATATTGAAGGAGCACGG - Intronic
933429517 2:82157698-82157720 TTGGGTATATTTAAGGAACATGG - Intergenic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
938962429 2:136355321-136355343 CTGGGTCAATGTCATGAGCAGGG + Intergenic
939582680 2:143968977-143968999 TTGGGTAAAGATAAGGAATAGGG - Intronic
940473574 2:154131370-154131392 CTGAGAAAAAATAAGTAGCAAGG - Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
943382773 2:187171830-187171852 CTGGGTTCATAGAAGGAGAAAGG + Intergenic
943408491 2:187517385-187517407 CTGGGTAAATATAAAAATTAAGG - Intronic
946451118 2:219780309-219780331 CAGGGCAAATATCAGGAGAAAGG + Intergenic
946479998 2:220045914-220045936 CAGGGTGAAAATAAGGGGCATGG + Intergenic
946878660 2:224156200-224156222 ATGGGCAAATATCAGAAGCAAGG - Intergenic
946963185 2:225006694-225006716 TTGGAGAAATAAAAGGAGCAAGG + Intronic
947620665 2:231588632-231588654 CTGGGTAAAGATAGGGAGCGGGG + Intergenic
948272276 2:236683756-236683778 CTGGGCAAGCATCAGGAGCAGGG - Intergenic
1171084093 20:22219958-22219980 CTGGAGAAAGATAAGGAGCCAGG - Intergenic
1171329227 20:24322930-24322952 CTGGGTAAAACTAAAGTGCAAGG - Intergenic
1172001794 20:31783995-31784017 TTGGGTAGATATTATGAGCAGGG + Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1175159006 20:56994231-56994253 CTGGGCAAACATCAGCAGCAAGG + Intergenic
1175683209 20:61006415-61006437 CTGGGTAGATTTAAGGATGAGGG + Intergenic
1178202510 21:30423435-30423457 TTGAGTAAATATTATGAGCATGG + Intronic
1181031363 22:20150124-20150146 CTGGGTAAATACAGGGCCCAGGG - Exonic
950549596 3:13658120-13658142 CTGGGTACAAAGAAGCAGCAAGG - Intergenic
950628277 3:14264465-14264487 CTGGGTAATTATAAAGAAAATGG - Intergenic
950892721 3:16418967-16418989 AGGGGAAAATTTAAGGAGCAAGG + Intronic
951029588 3:17866746-17866768 CTGAGTAAATATGATGAGAAGGG - Intronic
951171182 3:19543709-19543731 GTGGGAAAATACAAGAAGCATGG + Intergenic
951918332 3:27825404-27825426 CTGAGTTCATATAAGGAGCTGGG - Intergenic
952553767 3:34508439-34508461 CTGGGTTGGTACAAGGAGCAAGG - Intergenic
954397569 3:50300987-50301009 CTGGGAAAATACAAGAACCAAGG - Exonic
960714863 3:120564928-120564950 GGGGGTATATATAAGGAGAAGGG - Intergenic
962158429 3:132973857-132973879 ATGGGTAAGTATAAGAAGCCAGG + Intergenic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
964507465 3:157415201-157415223 ATGGATAAATATAAAGAGAAGGG - Intronic
967449151 3:189603261-189603283 CTGGGCACATATAAGGAGTTGGG - Intergenic
967653242 3:192012778-192012800 CTGAGAAAACAAAAGGAGCAAGG - Intergenic
969922784 4:10556774-10556796 CTGGTTAAAGAAAAGGAGAAGGG + Intronic
971456290 4:26847922-26847944 TGGGGAAAATATCAGGAGCATGG + Intergenic
976450194 4:85180357-85180379 CTAAGTTAATATAAGGGGCATGG + Intergenic
976560762 4:86497850-86497872 CTGTGCAAATATTAGGAGCAGGG + Intronic
980049446 4:128024510-128024532 CTGGGAAAATACAAAGAGTAGGG - Intronic
981464154 4:145047927-145047949 CTGGCTAAATATGATAAGCAAGG - Intronic
987452151 5:18098894-18098916 CTTGGTAACTAAAAGGAGCCTGG + Intergenic
989341794 5:40384432-40384454 CTGATTAAATATGAGGAGAAGGG + Intergenic
991116661 5:62963041-62963063 TTGGGTAAATACAAGAAGTATGG + Intergenic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
992484445 5:77181145-77181167 CTGGGTGAATAGACGGAGCGTGG + Intergenic
995396383 5:111691478-111691500 TTGGGTACATATAAGGAGCCAGG + Intronic
998065752 5:139156977-139156999 CTGTGTATAGAAAAGGAGCAAGG - Intronic
998102652 5:139447080-139447102 CTGGGTAATTATAAGGAAAGAGG - Intergenic
998316245 5:141185083-141185105 CGGGGTAAATATGAGGAAAAGGG - Exonic
999379259 5:151108831-151108853 CTGGGGTAGTAAAAGGAGCACGG + Intronic
1002778500 6:348838-348860 CTGGGTAAATATAAGGAGCAAGG + Exonic
1008392670 6:50971016-50971038 CTGGGAAGATTTAAAGAGCAAGG - Intergenic
1008474836 6:51925091-51925113 CTGAGTAAGTATGAGGAGCCTGG - Intronic
1008593163 6:53013856-53013878 CTGGCTTAATATAAGGAGGTGGG + Exonic
1009032576 6:58077916-58077938 ATGGGCAAATATAAGGAGCATGG + Intergenic
1009208186 6:60829687-60829709 ATGGGCAAATATAAGGAGCATGG + Intergenic
1009244380 6:61217557-61217579 CTAGATAAATATAATGATCATGG + Intergenic
1011165645 6:84442873-84442895 AGGGGTAAAGCTAAGGAGCAGGG + Intergenic
1013424823 6:110001660-110001682 CTCTGAAAATATAAGAAGCATGG - Intergenic
1014389584 6:120844242-120844264 CTGTGTAAATTTAAAGAGCCTGG + Intergenic
1014952432 6:127572601-127572623 CTGGGTAATTATCAGGATCCAGG + Intronic
1015054263 6:128881115-128881137 CTGGGAAAATGTAAAGAGGAAGG + Intergenic
1016389336 6:143559372-143559394 CTGAGGAAATATCAGGAGAAAGG + Intronic
1018554038 6:165032647-165032669 CTGGGGAAACATCAGGGGCAAGG - Intergenic
1018999678 6:168738935-168738957 CTGGTTAAATATAAGAAGGCTGG + Intergenic
1020260953 7:6530645-6530667 CTGGTTCAGTATAGGGAGCACGG + Intronic
1030913244 7:115279168-115279190 CTGGGTATATTTAAGGAGTGTGG + Intergenic
1035998449 8:4575002-4575024 CTCAGTAAATAAAAGGAGAAAGG + Intronic
1039037903 8:33379207-33379229 CTGGGTATTTATAAGGAGAGAGG - Intronic
1039088991 8:33808423-33808445 CTGGGAAAGTACAAGAAGCATGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043855653 8:85262232-85262254 CTGTGTAAAGATTAGGAGCATGG - Intronic
1044239893 8:89876711-89876733 GTGGGTAAAAATAAGGAAGAGGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1046271957 8:111908008-111908030 CTGGGTAAATAAAAGGTCCAAGG - Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1051506700 9:17834902-17834924 CTGGACAAAAATGAGGAGCAGGG - Intergenic
1051973483 9:22920210-22920232 TTGGGTATAAGTAAGGAGCAAGG - Intergenic
1052210005 9:25892915-25892937 CTGATTAAGTATAAGGAGTAAGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1055792235 9:79935203-79935225 ATGGGTAAGCAAAAGGAGCAGGG + Intergenic
1056188633 9:84163081-84163103 CTGGGGAAAAATAAGGAACCTGG + Intergenic
1059013088 9:110484127-110484149 ATGGCTAAATAGAAGGACCATGG + Intronic
1059036244 9:110756693-110756715 CTCAGCAAATATAAGGAGAAAGG - Intronic
1060903848 9:127287075-127287097 CTGGGTACATATATGGACCCAGG - Intronic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186070970 X:5820251-5820273 TTGGGTTAATAACAGGAGCATGG - Intergenic
1187300852 X:18048192-18048214 TTTGGTAAATATAAGAAGTAAGG + Intergenic
1188498939 X:30805350-30805372 CTGAGTCAATACAAGGCGCAAGG - Intergenic
1189186534 X:39060052-39060074 CTGAGGAAAGATAAGGATCAGGG - Intergenic
1190755029 X:53394301-53394323 ATGGGTAAATATGGGGAGGAAGG + Intronic
1191996390 X:67100211-67100233 CTGGGTAAATATAAGGGTGAGGG + Intergenic
1195485148 X:105396265-105396287 CTAAGTAAATATAATGATCAGGG + Intronic
1197014574 X:121608198-121608220 CTGGGTAATTATAAAGAAAAAGG + Intergenic
1198274844 X:135090536-135090558 CTGGGTAATTATAAAGAAAAAGG - Intergenic
1200838947 Y:7760849-7760871 AGGGGAAAATATAAGGAGCAAGG + Intergenic