ID: 1002778767

View in Genome Browser
Species Human (GRCh38)
Location 6:350561-350583
Sequence CCGCGCAGGTGCACAGGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002778762_1002778767 2 Left 1002778762 6:350536-350558 CCGGGAAAAACAAAGTTGCCTGA 0: 1
1: 1
2: 1
3: 30
4: 243
Right 1002778767 6:350561-350583 CCGCGCAGGTGCACAGGCCCCGG 0: 1
1: 0
2: 0
3: 19
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002778767 Original CRISPR CCGCGCAGGTGCACAGGCCC CGG Exonic
900229800 1:1550880-1550902 CCTGGGAGGTGCACAGACCCTGG + Intronic
900313791 1:2047406-2047428 CCTCTCAGGGGCACAGGCTCAGG + Intergenic
900671431 1:3857215-3857237 TCGCGCACGCGCAGAGGCCCTGG - Intergenic
901052254 1:6431070-6431092 CTGCCCAGCTGCTCAGGCCCTGG - Intronic
901157212 1:7148919-7148941 CTGAGCAGGTGCCCAGGACCTGG - Intronic
901815223 1:11789873-11789895 CTGGGCTGCTGCACAGGCCCAGG + Exonic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
904613978 1:31740006-31740028 CGGAGCAGGTGCACAGAGCCAGG + Exonic
904896541 1:33822298-33822320 CCTCACAGGTACCCAGGCCCTGG - Intronic
905800353 1:40838818-40838840 CCTGGCAGGGGCACAGCCCCGGG + Exonic
907509927 1:54950426-54950448 CCTCGCAGGAGCACAGGACATGG + Intergenic
909237657 1:73174411-73174433 AACCGCAGGTGCAGAGGCCCTGG - Intergenic
911691997 1:100845251-100845273 CCCCCCAGGTGCTCTGGCCCAGG + Intergenic
912369395 1:109161965-109161987 GCAGGCTGGTGCACAGGCCCGGG - Exonic
912933903 1:113986390-113986412 CTGGGCAGGAACACAGGCCCAGG - Intergenic
913076194 1:115342446-115342468 CAGCGAATCTGCACAGGCCCTGG + Intergenic
913189652 1:116402788-116402810 AGGTGCAAGTGCACAGGCCCTGG - Intronic
915443813 1:155963058-155963080 CCACGCAGGGGAACAGGCCCTGG + Exonic
919727690 1:200894770-200894792 CCCCGGAAGTGCAGAGGCCCAGG + Intronic
920690888 1:208145520-208145542 CCACGCAAGTGCCCAGGCTCTGG - Intronic
922725353 1:227920537-227920559 CCGTGCGGGTGCCCAGGCTCGGG - Exonic
922775504 1:228212698-228212720 CCGTGCAGGTGTAGAGGCCGCGG - Exonic
922815516 1:228446327-228446349 CCGCAACGGCGCACAGGCCCAGG - Intergenic
923306646 1:232694575-232694597 CCACGCAGGTGAACAGGTACAGG - Intergenic
923567900 1:235090488-235090510 CTGAGCAGCTGCACAGGGCCTGG - Intergenic
924384561 1:243489344-243489366 CCGTGCAGGTGAACAGACCCCGG + Intronic
1062813271 10:481200-481222 CAGCCCAGGTGAACAGGCCAGGG + Intronic
1062898774 10:1125953-1125975 CCGCACAGATGCAGAGGCCCAGG + Intronic
1063311416 10:4956245-4956267 ATGGGCAGGTGCACAGGCCAGGG + Intronic
1063316381 10:5010223-5010245 ATGGGCAGGTGCACAGGCCAGGG - Intronic
1063428099 10:5965311-5965333 CCGGGGATGGGCACAGGCCCTGG - Intronic
1065344808 10:24738464-24738486 CTGGGCAGGTGCACTGGCCTGGG - Intergenic
1071602058 10:86963118-86963140 CAGCACAGGTGGACAGGCCAAGG - Exonic
1072003653 10:91221099-91221121 CCCGGCAGGTGCGCGGGCCCAGG - Intronic
1073091235 10:100941531-100941553 CCTTGCAGGTGGAAAGGCCCTGG - Intronic
1073349548 10:102810089-102810111 GAGCTCAGGTGCACAGACCCAGG + Intronic
1073577840 10:104640577-104640599 CCGCGCGGGGGCGCAGGCCTTGG + Intergenic
1074553996 10:114471490-114471512 AAGCGCAGGTGCATTGGCCCGGG - Intronic
1075413829 10:122248418-122248440 ACGCGAGGCTGCACAGGCCCGGG + Intronic
1075480572 10:122777976-122777998 CCGAGTGGGTGCACTGGCCCAGG - Intergenic
1075711007 10:124530459-124530481 CCCCACAGGTTCTCAGGCCCAGG + Intronic
1076591145 10:131584444-131584466 CTGCACGGCTGCACAGGCCCAGG - Intergenic
1076911289 10:133391421-133391443 CCCCGCAGGTGCAGCAGCCCAGG + Exonic
1077421019 11:2450028-2450050 CCGAGCAGGGGCTCAGGACCAGG - Intronic
1078823338 11:14905051-14905073 CTGTCCGGGTGCACAGGCCCAGG + Intronic
1081995036 11:47358852-47358874 CCAGGCAGGAGCCCAGGCCCGGG + Exonic
1083863106 11:65436355-65436377 CAGCACAGGAGCAGAGGCCCAGG - Intergenic
1084534970 11:69751204-69751226 ATGTGCAGGTGCAAAGGCCCTGG + Intergenic
1084733072 11:71087080-71087102 CAGTGCAGCTGCACAGGCTCAGG + Intronic
1084787648 11:71452957-71452979 CCGTTCAGGTGCACAGGTGCAGG - Intergenic
1085751864 11:79168883-79168905 CTGCCCAGGTGAACAAGCCCAGG + Intronic
1089794324 11:120967866-120967888 GGGAACAGGTGCACAGGCCCTGG - Intronic
1091307187 11:134543794-134543816 CCCAGCATGTGCAAAGGCCCCGG - Intergenic
1094851638 12:34384889-34384911 CCGCGCATGTGCAGAGCCCACGG - Intergenic
1096898183 12:54846312-54846334 ACGGGCAGGTGCAGAGGCCATGG - Intronic
1098585245 12:72146621-72146643 ACGGGCAGGTGCAGAGGCCTCGG + Intronic
1102514908 12:113439911-113439933 CCGTGCAGCATCACAGGCCCTGG + Intergenic
1103500857 12:121400497-121400519 CCGAGGAGGCGCACAGGGCCCGG - Intronic
1103704025 12:122861790-122861812 CAGGGCAGTTGCAGAGGCCCAGG - Exonic
1103937560 12:124484616-124484638 CCCAGCAGGTGCAAAGGCCCTGG - Intronic
1104599494 12:130142837-130142859 CCCTGCAGGTGCCCCGGCCCAGG - Intergenic
1104715384 12:131012840-131012862 CGGGGGAGGTGCACAGGACCCGG + Intronic
1104836542 12:131795653-131795675 CTGGGCCTGTGCACAGGCCCTGG + Intronic
1104939593 12:132388724-132388746 AGGAGCAGGTGCAAAGGCCCTGG + Intergenic
1106546069 13:30732108-30732130 CAGAGCACGTGCAGAGGCCCGGG - Intronic
1106720110 13:32427865-32427887 GGGCGCCGGTGCACGGGCCCGGG - Intronic
1107125302 13:36839842-36839864 ACGGGCAGGTGCAGAGGCCGTGG + Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107534064 13:41311215-41311237 CCGCGCATGCGCACAGGATCCGG + Exonic
1109823933 13:67692610-67692632 CACCGCAGGTCCAGAGGCCCAGG - Intergenic
1111405040 13:87793085-87793107 ACGGGCAGGTGCAGAGGCTCTGG + Intergenic
1113373948 13:109746473-109746495 CGCAGCAGGTGCAAAGGCCCCGG - Intergenic
1113473903 13:110566263-110566285 CCCAGCAGGTGCTGAGGCCCAGG - Intergenic
1113841175 13:113362730-113362752 CCGCCCAGGTGCAGGGCCCCTGG + Intronic
1118753184 14:68821116-68821138 CAGCGCAGGTTCACAGGCGAGGG + Intergenic
1119425552 14:74532507-74532529 CCGCGTCCTTGCACAGGCCCAGG + Exonic
1122065970 14:99174796-99174818 CCGCGCCGCTGCCCAGCCCCGGG - Exonic
1122270346 14:100566174-100566196 CAGCCCAGGAGCCCAGGCCCTGG + Intronic
1122589443 14:102836192-102836214 AGGAGCAGGTGCACAGGCCCTGG - Intronic
1123068418 14:105629477-105629499 CAGGGCAGGGGCACAGGCTCGGG - Intergenic
1123092446 14:105747803-105747825 CAGGGCAGGGGCACAGGCTCGGG - Intergenic
1123098014 14:105775504-105775526 CAGGGCAGGAGCACAGGCTCAGG - Intergenic
1124652353 15:31483406-31483428 CAGCGCCGCTGCACCGGCCCCGG + Exonic
1125792062 15:42374450-42374472 CCTAGCAGGTGTTCAGGCCCTGG + Intronic
1129032305 15:72628342-72628364 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1129217591 15:74108897-74108919 CCTAGCATGTGCCCAGGCCCAGG + Intronic
1129407068 15:75327088-75327110 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1129734752 15:77953198-77953220 CCTAGCATGTGCCCAGGCCCAGG + Intergenic
1129840838 15:78742793-78742815 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1130772240 15:86936094-86936116 CAGCCCTGGTGCCCAGGCCCTGG + Intronic
1132319839 15:100918109-100918131 CCGCGAGGGAGCGCAGGCCCAGG - Intergenic
1132745439 16:1434323-1434345 CCGCTCAGCCCCACAGGCCCTGG + Intergenic
1133035838 16:3033818-3033840 CCAAGGAGGTGCACAGGCTCTGG + Intronic
1133242824 16:4425853-4425875 CGGCGCAGGCGCAGAGTCCCCGG + Exonic
1134104465 16:11476069-11476091 CACAGCAGGTGCAAAGGCCCTGG + Intronic
1134567710 16:15265693-15265715 CCGCGCCAGTCCACAGTCCCAGG + Intergenic
1135091504 16:19521779-19521801 CCCTGCAGGTGCTCAAGCCCCGG - Exonic
1135752778 16:25070269-25070291 CCCAGCAGCTGCCCAGGCCCTGG + Intergenic
1136065350 16:27754705-27754727 GGGGGCAGGTGCACAGGCCCAGG + Intronic
1137426614 16:48385516-48385538 GCGCGCAGGCGCACAGGCGTTGG + Intronic
1141171413 16:81693970-81693992 CTGCCCATGTGCACAGGCTCAGG - Intronic
1141431667 16:83973364-83973386 GAGGGCAGGTGCACAGGCCTGGG + Intronic
1142712291 17:1730200-1730222 CGGCAGAGGTGCCCAGGCCCTGG - Intronic
1144127915 17:12220165-12220187 CAGCCCAGGTCCACAGCCCCTGG - Intergenic
1146303478 17:31710004-31710026 CCGCGCAGGAGCACACTCACTGG - Intergenic
1149626595 17:58084157-58084179 CCGGCCAGGTCCGCAGGCCCCGG - Intronic
1152239673 17:79154855-79154877 CTGCACAGGTGCACATGCACAGG + Intronic
1153480513 18:5543158-5543180 CCCGGCAGGTGCCCAGGCCCAGG + Intronic
1153688576 18:7568540-7568562 GCGGGCAGGTCCCCAGGCCCTGG + Intronic
1155822167 18:30391403-30391425 ACGGGCAGGTGCACAAGCCAGGG - Intergenic
1157848922 18:51030025-51030047 CCGCGCTGAGGCCCAGGCCCAGG + Intronic
1160543560 18:79638437-79638459 CCACGCAGCTGCCCAGGCCCCGG - Intergenic
1160677569 19:399533-399555 CCGGGCAGGTGCACACTCCCAGG + Intergenic
1161074069 19:2276475-2276497 CCTTGCAGGTGCCCAAGCCCGGG - Exonic
1161349925 19:3785909-3785931 ACGCGCGGGTACACACGCCCGGG + Intronic
1161611251 19:5244192-5244214 CCGCACAGGCGAGCAGGCCCCGG - Exonic
1162573085 19:11483599-11483621 CCTCGCAGCTGTCCAGGCCCCGG + Exonic
1163153971 19:15430066-15430088 CCTCGCAGGTGGTCAGGCTCTGG + Intronic
1163625825 19:18388947-18388969 CCGCGCAGGTGCACAGTGGAAGG - Exonic
1164382533 19:27747109-27747131 CCGCTCTGGTGCACTGGACCTGG - Intergenic
1164796716 19:31039638-31039660 CCGGGAGGGTGCACAGTCCCAGG + Intergenic
1167619620 19:50553465-50553487 AAGAGCAGGTGCAAAGGCCCTGG - Intronic
1168011711 19:53538442-53538464 CCGCCGAGGTTCACAGGCACGGG - Intronic
1168262953 19:55207181-55207203 CTGTCCAGCTGCACAGGCCCTGG + Exonic
1168351529 19:55678877-55678899 CCGGGCAGGTGCAGGGGCTCAGG + Intronic
1168659928 19:58157591-58157613 CCGCGCAGGAGCCCAGGGCGGGG - Intergenic
925162454 2:1695356-1695378 CCTCTCAGGTGCTCAGACCCAGG - Intronic
925162523 2:1695651-1695673 CCTCTCAGGTGCTCAGACCCAGG - Intronic
925162593 2:1695946-1695968 CCTCTCAGGTGCTCAGACCCAGG - Intronic
925166578 2:1719352-1719374 CTGAGCAGGGGCACAGACCCAGG - Intronic
925179311 2:1806687-1806709 CCGCCCAGGTGGACCAGCCCAGG + Intronic
925293935 2:2765669-2765691 CCCCGCAGGTGGCCAGGCCTGGG + Intergenic
927150596 2:20193174-20193196 CTGCAGAGGTGAACAGGCCCAGG - Intergenic
930209294 2:48617836-48617858 CCGCGCAGGCGCAAAGGGCCAGG + Exonic
931392221 2:61854052-61854074 CAGCGCAGGCGCTCAGGCCTCGG - Exonic
933602509 2:84347688-84347710 CCCCGTAGGGGCTCAGGCCCAGG + Intergenic
933970157 2:87463680-87463702 CCTCCAAGGTGCACAGCCCCTGG + Intergenic
934522226 2:95026570-95026592 GACCGCAGGTGCAGAGGCCCCGG - Intronic
935815501 2:106843086-106843108 CAGCGCAGCTGCGCAGGCCGCGG + Exonic
936082881 2:109446849-109446871 CAGCCCAGGGGCACAGACCCTGG + Intronic
936323625 2:111486816-111486838 CCTCCAAGGTGCACAGCCCCTGG - Intergenic
936792266 2:116164370-116164392 CATCGCAGGTCCAGAGGCCCTGG + Intergenic
937298692 2:120825280-120825302 CTGCACAGGTGGACAGGGCCAGG - Intronic
937392877 2:121506600-121506622 CTGTGCACATGCACAGGCCCAGG + Intronic
938379482 2:130828546-130828568 CAGGGGAGGTGCCCAGGCCCAGG + Intergenic
941233293 2:162938598-162938620 ACAGGCAGGTGCAGAGGCCCGGG - Intergenic
945194760 2:207227666-207227688 CTGCGCTGGTGCAGAAGCCCAGG + Intergenic
946203266 2:218083988-218084010 TAGGGCAGGTCCACAGGCCCAGG - Intronic
946397971 2:219452845-219452867 CTGCTCAGGTGCTGAGGCCCTGG - Intronic
948641689 2:239379291-239379313 CCGCGCAGGTGGGCGAGCCCCGG + Intronic
1168838701 20:894997-895019 CCGCCCACCAGCACAGGCCCTGG + Intronic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169137220 20:3204433-3204455 CCGCCCAGGTGCGCACGCGCAGG + Intronic
1169914970 20:10674731-10674753 CCGCGCCGGGGCAGAGGCGCGGG + Intergenic
1173640908 20:44601259-44601281 CCTGGCAGGTGCAGAGGCCAAGG + Intronic
1173902582 20:46601773-46601795 AAGAGCAGGTGCAAAGGCCCTGG + Intronic
1174082793 20:47983019-47983041 CACAGCAGGTGCACAGGCCCCGG + Intergenic
1174087377 20:48018768-48018790 AGCAGCAGGTGCACAGGCCCTGG - Intergenic
1174128911 20:48328202-48328224 AGCAGCAGGTGCACAGGCCCTGG + Intergenic
1174133162 20:48359963-48359985 CACAGCAGGTGCACAGGCCCCGG - Intergenic
1175172448 20:57090098-57090120 CCGTGCAGGTGCACACAGCCCGG + Intergenic
1175600397 20:60267979-60268001 CCCAGCAGGTGCCCAGTCCCTGG + Intergenic
1175799227 20:61791804-61791826 ACCCGCAAGTGCAAAGGCCCTGG + Intronic
1176022168 20:62967425-62967447 CCAGGAAGGTGCACAGCCCCAGG - Exonic
1178493856 21:33070969-33070991 CGGCGCAGGTGCAGAGGCCGGGG - Exonic
1179448642 21:41452367-41452389 CTGTGCAGGTCCCCAGGCCCCGG + Intronic
1179809854 21:43864228-43864250 CTGCTCAGGTCCTCAGGCCCCGG - Intergenic
1180796482 22:18608284-18608306 GCGTGCCGGGGCACAGGCCCTGG + Exonic
1181177869 22:21047961-21047983 TGGGGCAGGTGCAGAGGCCCTGG + Exonic
1181225241 22:21386987-21387009 GCGTGCCGGGGCACAGGCCCTGG - Exonic
1181253391 22:21547826-21547848 GCGTGCCGGGGCACAGGCCCTGG + Exonic
1181401508 22:22652841-22652863 GCGCGCACGTGCACTGGCCCAGG + Intergenic
1181460744 22:23084643-23084665 AAGCGCAGGTGCTCAGGACCAGG - Intronic
1182102832 22:27669993-27670015 CCCCTCACGTGCACAGGCCGTGG - Intergenic
1182485279 22:30635512-30635534 CTGGGCAGATGCGCAGGCCCCGG + Intergenic
1182622537 22:31625921-31625943 CCTCGCAGAGGCAGAGGCCCTGG - Exonic
1184653155 22:45928384-45928406 CCCCACAGGTGCACAGGGTCGGG + Intronic
1184696985 22:46145337-46145359 CCACTCAGCTGCACAGGCTCCGG + Intergenic
1185338293 22:50280474-50280496 CTGCGCAGGTGCACATGGGCGGG - Exonic
949926501 3:9046367-9046389 CCATGCAGATGCAAAGGCCCTGG + Intronic
950045156 3:9944713-9944735 CAGCCCAGGTACCCAGGCCCGGG + Exonic
950632674 3:14293454-14293476 CCGCGCAGGGGCACACGGCAGGG - Intergenic
953018286 3:39098421-39098443 CAGCCCAGGTGCCCAAGCCCAGG - Exonic
953407284 3:42665691-42665713 ACCCACCGGTGCACAGGCCCAGG - Exonic
953457537 3:43054877-43054899 ATGCCCAGGTGCACAGGCACAGG + Intronic
953901541 3:46846560-46846582 CCACTCAGGGACACAGGCCCCGG - Intergenic
954223981 3:49171234-49171256 CCGCGGAGGTGGGCAGGCGCCGG + Intergenic
954442701 3:50530498-50530520 CCGCGCATGTGCACCCGTCCAGG + Intergenic
955411515 3:58658472-58658494 ACTCGCAAGTGCAAAGGCCCGGG - Intronic
957584304 3:82114521-82114543 CCACCCAGGGGCTCAGGCCCAGG + Intergenic
961631360 3:128301407-128301429 CCGCCCATGTGCAGAGCCCCAGG - Intronic
962369056 3:134805620-134805642 CTGCACAGCTGCACATGCCCTGG + Intronic
968453649 4:686712-686734 CAGCGCAGGGCCACAGACCCCGG + Intronic
969303118 4:6309111-6309133 CCGCGCAGGAGCCCACGGCCAGG + Intergenic
969690549 4:8701821-8701843 CCGCCCAGCAGCACAGCCCCAGG + Intergenic
970401082 4:15718642-15718664 CCACGCACATGCACTGGCCCTGG + Intronic
970494327 4:16609701-16609723 CCGCCTAGGGGCTCAGGCCCAGG - Intronic
974962784 4:68724565-68724587 CCAGGCAGGTGCAGAGGCCAGGG + Intergenic
978457089 4:108906283-108906305 ACGCCTAGGTGCAAAGGCCCTGG - Intronic
978656857 4:111075043-111075065 CCCCGTAGGGGCTCAGGCCCAGG - Intergenic
982197155 4:152928081-152928103 CAGAGTAGGTGCACAGGCCTGGG - Intergenic
982474681 4:155835269-155835291 ACGGGCAGGTGCAGAGGCCAGGG - Intronic
984928321 4:184825858-184825880 CCGCGGCGGTGCCCGGGCCCCGG - Intronic
985041179 4:185893353-185893375 CCGCGCTGGAGCAAAGGCTCTGG + Intronic
990620078 5:57550073-57550095 CCCCACAGGGGCTCAGGCCCAGG + Intergenic
991298221 5:65103222-65103244 CGGCGCAGGTCCCCGGGCCCTGG + Intergenic
996738246 5:126776841-126776863 CCGCGCGGGTGGGCAGTCCCAGG + Intronic
997120185 5:131165297-131165319 CTGCGCAGGTGCCCCGGCTCTGG + Exonic
997391902 5:133524098-133524120 CACAGCATGTGCACAGGCCCAGG + Intronic
998533920 5:142911379-142911401 TGGAGCAGGTGGACAGGCCCTGG - Intronic
999341836 5:150779360-150779382 CCAAGCAGGTGCTCAGGCCCGGG - Intronic
1000524895 5:162345548-162345570 CCGCTCTGTTGCCCAGGCCCAGG + Intergenic
1001420923 5:171586651-171586673 CCAGGCAGGTGCCCAGACCCTGG + Intergenic
1001654589 5:173339910-173339932 CAGTGCAAGTGCAGAGGCCCTGG + Intergenic
1002102886 5:176866098-176866120 CCGCCCAGGCCCACTGGCCCGGG + Intronic
1002453554 5:179332795-179332817 CCAGGCAGGTGCCCAGGCCCTGG - Intronic
1002778767 6:350561-350583 CCGCGCAGGTGCACAGGCCCCGG + Exonic
1003084525 6:3051158-3051180 CTGTGCAGGAGCACAGGCACAGG + Intergenic
1003403676 6:5811016-5811038 CACAGCAGGTGCAAAGGCCCCGG + Intergenic
1005529613 6:26689751-26689773 CCGCGCAGGCGCTCACGGCCCGG + Intergenic
1005541183 6:26811896-26811918 CCGCGCAGGCGCTCACGGCCCGG - Intergenic
1006404220 6:33834788-33834810 CCCCACAGGTGAGCAGGCCCAGG + Intergenic
1006914639 6:37586354-37586376 CAGAGCAGGTGCACATGCTCAGG - Intergenic
1009707100 6:67266203-67266225 CCCCGCAGGGGCTCAGTCCCAGG + Intergenic
1018581145 6:165309303-165309325 CCGCGCAGGTCCACACTCGCTGG + Intronic
1018677640 6:166236649-166236671 GGGCGCAGGTGCAAAGGCCCTGG + Intergenic
1018828782 6:167425961-167425983 CCGGGCCAGTGCAGAGGCCCTGG - Intergenic
1018904166 6:168065394-168065416 CCCTGGAGGTGCACAGGGCCTGG + Intronic
1019511397 7:1419397-1419419 ACCTGCAGGTGCAAAGGCCCGGG - Intergenic
1019665925 7:2252368-2252390 CCGGGCAGGTCCCCAGGCTCAGG - Exonic
1025041720 7:55651495-55651517 CCCCGCAGGGGCTCAGTCCCAGG - Intergenic
1025236307 7:57237037-57237059 ACCCGCATGTGCAAAGGCCCTGG - Intergenic
1029297449 7:99552255-99552277 CCGAGGAGGTGCACAGGGCGGGG + Intronic
1032168066 7:129561425-129561447 CCAGGCAGGTTCCCAGGCCCTGG - Intergenic
1032344295 7:131105744-131105766 CCGCGCGGGTGCCCCGGCGCTGG - Intergenic
1032513895 7:132493030-132493052 CCTCCCAGGTCTACAGGCCCTGG - Intronic
1033564794 7:142567867-142567889 ACGGGCAGGTGCAGAGGCCATGG - Intergenic
1034808177 7:154106731-154106753 GAGAGCAGGTGCACAGTCCCTGG + Intronic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1035490576 7:159272939-159272961 ATGGGCAGGTGCACAGGCCAGGG - Intergenic
1036648311 8:10625733-10625755 CCACGCAGGAGCAGAGGGCCTGG + Intronic
1037788882 8:21919606-21919628 CCGCTCAGCTGCGCAGGCCCCGG - Intergenic
1037819629 8:22129426-22129448 CCGCTGAGGGGCACTGGCCCAGG - Intronic
1037879062 8:22564275-22564297 CCACGCAGGTGCTCAGACGCCGG + Exonic
1039075906 8:33690138-33690160 ACGGGCAGGTGCAGGGGCCCTGG - Intergenic
1049224768 8:141444948-141444970 CCGCGAAGGGGCCCAGGCTCCGG - Intergenic
1049366075 8:142237476-142237498 CCCCGTGAGTGCACAGGCCCTGG + Intronic
1049719033 8:144107154-144107176 CCTCTCAGGTGGACAGGTCCAGG - Exonic
1053493827 9:38533845-38533867 CTCTGCAAGTGCACAGGCCCTGG - Intergenic
1056117911 9:83459539-83459561 CTGTGCATGTGCACAGGCCTAGG - Intronic
1056710959 9:88991540-88991562 CCGAGCAGGACCCCAGGCCCGGG + Exonic
1057834799 9:98435705-98435727 AAGAGCAGGTGCAAAGGCCCTGG - Intronic
1059119721 9:111631280-111631302 CCGCGCAGGCGCACAGGGCGCGG - Intergenic
1061065703 9:128276299-128276321 CCTCTCAGGTGCACCGGGCCAGG - Exonic
1061283142 9:129608805-129608827 CTGGGCAGGTGCACAGGGTCCGG - Intergenic
1061727688 9:132590373-132590395 CCGCGCATGTCCACAGCACCGGG - Intergenic
1061951430 9:133938453-133938475 GCTGGCAGGTGCAAAGGCCCTGG - Intronic
1062008169 9:134252173-134252195 GACAGCAGGTGCACAGGCCCGGG - Intergenic
1062391148 9:136334377-136334399 CCACGGAGGTGCTCCGGCCCCGG + Intronic
1062489867 9:136799877-136799899 CGGAGCAGGTGCCCAGCCCCAGG + Intronic
1190797907 X:53761015-53761037 CTGCACAGGTGCATAGGTCCAGG - Intergenic
1190917252 X:54820195-54820217 CTGCACAGGTGCATAGGTCCAGG + Intergenic
1192553938 X:72075405-72075427 CCACCCAGCAGCACAGGCCCAGG - Intergenic
1197046447 X:122003984-122004006 CCCCCTAGGTGCTCAGGCCCAGG + Intergenic
1197049524 X:122042330-122042352 CCCCCCAGGGGCTCAGGCCCAGG + Intergenic
1197782307 X:130171178-130171200 CCTCTCAGCTGTACAGGCCCCGG + Intergenic
1198534648 X:137574341-137574363 CCGCGCGGGTGCCCAGGGGCTGG + Intronic
1200229487 X:154437007-154437029 CCGCGCTGGTGCTGTGGCCCGGG + Exonic