ID: 1002778947

View in Genome Browser
Species Human (GRCh38)
Location 6:352032-352054
Sequence GAGTGTCCCCTCACGCTCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002778947_1002778953 14 Left 1002778947 6:352032-352054 CCGATGAGCGTGAGGGGACACTC No data
Right 1002778953 6:352069-352091 GGCACAGGTGGCTCTGTCCTCGG No data
1002778947_1002778951 2 Left 1002778947 6:352032-352054 CCGATGAGCGTGAGGGGACACTC No data
Right 1002778951 6:352057-352079 AATGCCTGGTATGGCACAGGTGG No data
1002778947_1002778950 -1 Left 1002778947 6:352032-352054 CCGATGAGCGTGAGGGGACACTC No data
Right 1002778950 6:352054-352076 CTGAATGCCTGGTATGGCACAGG No data
1002778947_1002778949 -7 Left 1002778947 6:352032-352054 CCGATGAGCGTGAGGGGACACTC No data
Right 1002778949 6:352048-352070 GACACTCTGAATGCCTGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002778947 Original CRISPR GAGTGTCCCCTCACGCTCAT CGG (reversed) Intergenic
No off target data available for this crispr