ID: 1002779853

View in Genome Browser
Species Human (GRCh38)
Location 6:357683-357705
Sequence GAGGTCTTTGGGGATAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002779853_1002779869 26 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779869 6:357732-357754 GAGCACGGCCAACAGCCATTGGG No data
1002779853_1002779866 11 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779853_1002779861 -7 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779861 6:357699-357721 AGACCTCCCATTAGATGGCAGGG No data
1002779853_1002779860 -8 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779860 6:357698-357720 AAGACCTCCCATTAGATGGCAGG No data
1002779853_1002779868 25 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779853_1002779863 -4 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779863 6:357702-357724 CCTCCCATTAGATGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002779853 Original CRISPR GAGGTCTTTGGGGATAGAAG GGG (reversed) Intergenic
No off target data available for this crispr