ID: 1002779855

View in Genome Browser
Species Human (GRCh38)
Location 6:357685-357707
Sequence GGGAGGTCTTTGGGGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002779855_1002779868 23 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779855_1002779860 -10 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779860 6:357698-357720 AAGACCTCCCATTAGATGGCAGG No data
1002779855_1002779863 -6 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779863 6:357702-357724 CCTCCCATTAGATGGCAGGGTGG No data
1002779855_1002779869 24 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779869 6:357732-357754 GAGCACGGCCAACAGCCATTGGG No data
1002779855_1002779866 9 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779855_1002779861 -9 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779861 6:357699-357721 AGACCTCCCATTAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002779855 Original CRISPR GGGAGGTCTTTGGGGATAGA AGG (reversed) Intergenic
No off target data available for this crispr