ID: 1002779859

View in Genome Browser
Species Human (GRCh38)
Location 6:357695-357717
Sequence GCCATCTAATGGGAGGTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002779859_1002779869 14 Left 1002779859 6:357695-357717 CCAAAGACCTCCCATTAGATGGC No data
Right 1002779869 6:357732-357754 GAGCACGGCCAACAGCCATTGGG No data
1002779859_1002779871 27 Left 1002779859 6:357695-357717 CCAAAGACCTCCCATTAGATGGC No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data
1002779859_1002779866 -1 Left 1002779859 6:357695-357717 CCAAAGACCTCCCATTAGATGGC No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779859_1002779868 13 Left 1002779859 6:357695-357717 CCAAAGACCTCCCATTAGATGGC No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002779859 Original CRISPR GCCATCTAATGGGAGGTCTT TGG (reversed) Intergenic
No off target data available for this crispr