ID: 1002779866

View in Genome Browser
Species Human (GRCh38)
Location 6:357717-357739
Sequence CAGGGTGGTCAACCTGAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002779854_1002779866 10 Left 1002779854 6:357684-357706 CCCTTCTATCCCCAAAGACCTCC No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779857_1002779866 0 Left 1002779857 6:357694-357716 CCCAAAGACCTCCCATTAGATGG No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779859_1002779866 -1 Left 1002779859 6:357695-357717 CCAAAGACCTCCCATTAGATGGC No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779855_1002779866 9 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779862_1002779866 -8 Left 1002779862 6:357702-357724 CCTCCCATTAGATGGCAGGGTGG No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779853_1002779866 11 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data
1002779856_1002779866 1 Left 1002779856 6:357693-357715 CCCCAAAGACCTCCCATTAGATG No data
Right 1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002779866 Original CRISPR CAGGGTGGTCAACCTGAGCA CGG Intergenic
No off target data available for this crispr