ID: 1002779868

View in Genome Browser
Species Human (GRCh38)
Location 6:357731-357753
Sequence TGAGCACGGCCAACAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002779864_1002779868 3 Left 1002779864 6:357705-357727 CCCATTAGATGGCAGGGTGGTCA No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779853_1002779868 25 Left 1002779853 6:357683-357705 CCCCTTCTATCCCCAAAGACCTC No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779865_1002779868 2 Left 1002779865 6:357706-357728 CCATTAGATGGCAGGGTGGTCAA No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779859_1002779868 13 Left 1002779859 6:357695-357717 CCAAAGACCTCCCATTAGATGGC No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779854_1002779868 24 Left 1002779854 6:357684-357706 CCCTTCTATCCCCAAAGACCTCC No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779857_1002779868 14 Left 1002779857 6:357694-357716 CCCAAAGACCTCCCATTAGATGG No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779855_1002779868 23 Left 1002779855 6:357685-357707 CCTTCTATCCCCAAAGACCTCCC No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779862_1002779868 6 Left 1002779862 6:357702-357724 CCTCCCATTAGATGGCAGGGTGG No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data
1002779856_1002779868 15 Left 1002779856 6:357693-357715 CCCCAAAGACCTCCCATTAGATG No data
Right 1002779868 6:357731-357753 TGAGCACGGCCAACAGCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002779868 Original CRISPR TGAGCACGGCCAACAGCCAT TGG Intergenic
No off target data available for this crispr