ID: 1002779871

View in Genome Browser
Species Human (GRCh38)
Location 6:357745-357767
Sequence AGCCATTGGGCGCTGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002779859_1002779871 27 Left 1002779859 6:357695-357717 CCAAAGACCTCCCATTAGATGGC No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data
1002779864_1002779871 17 Left 1002779864 6:357705-357727 CCCATTAGATGGCAGGGTGGTCA No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data
1002779856_1002779871 29 Left 1002779856 6:357693-357715 CCCCAAAGACCTCCCATTAGATG No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data
1002779867_1002779871 -7 Left 1002779867 6:357729-357751 CCTGAGCACGGCCAACAGCCATT No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data
1002779862_1002779871 20 Left 1002779862 6:357702-357724 CCTCCCATTAGATGGCAGGGTGG No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data
1002779865_1002779871 16 Left 1002779865 6:357706-357728 CCATTAGATGGCAGGGTGGTCAA No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data
1002779857_1002779871 28 Left 1002779857 6:357694-357716 CCCAAAGACCTCCCATTAGATGG No data
Right 1002779871 6:357745-357767 AGCCATTGGGCGCTGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002779871 Original CRISPR AGCCATTGGGCGCTGATGCA TGG Intergenic
No off target data available for this crispr