ID: 1002779873

View in Genome Browser
Species Human (GRCh38)
Location 6:357755-357777
Sequence CGCTGATGCATGGCGAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002779864_1002779873 27 Left 1002779864 6:357705-357727 CCCATTAGATGGCAGGGTGGTCA No data
Right 1002779873 6:357755-357777 CGCTGATGCATGGCGAGAACTGG No data
1002779862_1002779873 30 Left 1002779862 6:357702-357724 CCTCCCATTAGATGGCAGGGTGG No data
Right 1002779873 6:357755-357777 CGCTGATGCATGGCGAGAACTGG No data
1002779870_1002779873 -8 Left 1002779870 6:357740-357762 CCAACAGCCATTGGGCGCTGATG No data
Right 1002779873 6:357755-357777 CGCTGATGCATGGCGAGAACTGG No data
1002779865_1002779873 26 Left 1002779865 6:357706-357728 CCATTAGATGGCAGGGTGGTCAA No data
Right 1002779873 6:357755-357777 CGCTGATGCATGGCGAGAACTGG No data
1002779867_1002779873 3 Left 1002779867 6:357729-357751 CCTGAGCACGGCCAACAGCCATT No data
Right 1002779873 6:357755-357777 CGCTGATGCATGGCGAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002779873 Original CRISPR CGCTGATGCATGGCGAGAAC TGG Intergenic
No off target data available for this crispr