ID: 1002782386

View in Genome Browser
Species Human (GRCh38)
Location 6:377356-377378
Sequence CCCCAAAGCCCACACTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002782379_1002782386 17 Left 1002782379 6:377316-377338 CCAGCGGGTCATAAGCAGTCTGA No data
Right 1002782386 6:377356-377378 CCCCAAAGCCCACACTGGGGAGG No data
1002782378_1002782386 18 Left 1002782378 6:377315-377337 CCCAGCGGGTCATAAGCAGTCTG No data
Right 1002782386 6:377356-377378 CCCCAAAGCCCACACTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002782386 Original CRISPR CCCCAAAGCCCACACTGGGG AGG Intergenic
No off target data available for this crispr