ID: 1002782397

View in Genome Browser
Species Human (GRCh38)
Location 6:377407-377429
Sequence CAGAAGGCCGAGAGGCCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002782385_1002782397 28 Left 1002782385 6:377356-377378 CCCCAAAGCCCACACTGGGGAGG No data
Right 1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG No data
1002782388_1002782397 26 Left 1002782388 6:377358-377380 CCAAAGCCCACACTGGGGAGGCG No data
Right 1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG No data
1002782384_1002782397 29 Left 1002782384 6:377355-377377 CCCCCAAAGCCCACACTGGGGAG No data
Right 1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG No data
1002782390_1002782397 19 Left 1002782390 6:377365-377387 CCACACTGGGGAGGCGACTTGAA No data
Right 1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG No data
1002782389_1002782397 20 Left 1002782389 6:377364-377386 CCCACACTGGGGAGGCGACTTGA No data
Right 1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG No data
1002782387_1002782397 27 Left 1002782387 6:377357-377379 CCCAAAGCCCACACTGGGGAGGC No data
Right 1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002782397 Original CRISPR CAGAAGGCCGAGAGGCCCAG AGG Intergenic
No off target data available for this crispr