ID: 1002785794

View in Genome Browser
Species Human (GRCh38)
Location 6:398925-398947
Sequence GGCGTTCTCAGGTGAGTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002785783_1002785794 20 Left 1002785783 6:398882-398904 CCGGAGTCCCCACAGAGCCAAGC 0: 1
1: 0
2: 0
3: 27
4: 270
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1002785786_1002785794 12 Left 1002785786 6:398890-398912 CCCACAGAGCCAAGCATAAGGTC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1002785788_1002785794 3 Left 1002785788 6:398899-398921 CCAAGCATAAGGTCTGCCGAAGC 0: 1
1: 0
2: 0
3: 6
4: 41
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1002785780_1002785794 29 Left 1002785780 6:398873-398895 CCCAGGCTCCCGGAGTCCCCACA 0: 1
1: 0
2: 2
3: 25
4: 273
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1002785782_1002785794 21 Left 1002785782 6:398881-398903 CCCGGAGTCCCCACAGAGCCAAG 0: 1
1: 0
2: 2
3: 22
4: 269
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1002785781_1002785794 28 Left 1002785781 6:398874-398896 CCAGGCTCCCGGAGTCCCCACAG 0: 1
1: 0
2: 1
3: 35
4: 345
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1002785787_1002785794 11 Left 1002785787 6:398891-398913 CCACAGAGCCAAGCATAAGGTCT 0: 1
1: 0
2: 2
3: 18
4: 260
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1002785785_1002785794 13 Left 1002785785 6:398889-398911 CCCCACAGAGCCAAGCATAAGGT 0: 1
1: 0
2: 0
3: 21
4: 171
Right 1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002785794 Original CRISPR GGCGTTCTCAGGTGAGTGCA GGG Exonic
900137379 1:1123614-1123636 GGTGTGCTCAGGTTTGTGCACGG - Intergenic
900137396 1:1123739-1123761 GGTGTGCACAGGTGTGTGCATGG - Intergenic
900177798 1:1298480-1298502 GGGGTCCTCAGGTGGGGGCAGGG - Intronic
900510861 1:3060458-3060480 GGCGCTCTCCGGGGTGTGCAGGG - Intergenic
901073094 1:6533414-6533436 GGAGTCCTCAGGTGAGTGAAAGG + Exonic
902086118 1:13863967-13863989 GGCTTTCTCAAGTAAGAGCAAGG + Intergenic
902210655 1:14902108-14902130 AGCGTTTTCAAGTGCGTGCACGG - Intronic
902640160 1:17761971-17761993 GGTGACCTCAGGTGAGCGCATGG - Intronic
904736204 1:32636049-32636071 GGTGGTGTCAGCTGAGTGCAGGG - Intronic
906214378 1:44030513-44030535 GGCGGCCGCAGGTGAGGGCAGGG - Intronic
907706018 1:56833477-56833499 GGCCTTCTCAGCTCAGTGAAGGG - Intergenic
910149412 1:84124667-84124689 AGGGTTCTCATGTGAGTGAAAGG + Intronic
920195311 1:204222654-204222676 GGCATTCCCATGGGAGTGCAGGG + Exonic
920822981 1:209398668-209398690 GGCGGAGGCAGGTGAGTGCAGGG - Intergenic
922438657 1:225632208-225632230 GTGGTTCTCAGCTGGGTGCAGGG + Intronic
922792000 1:228315970-228315992 GGCGTTCTCCGAGGTGTGCACGG - Exonic
923166935 1:231374429-231374451 GGTGTTCTGAGGTGAGCTCAAGG - Intronic
923520694 1:234733047-234733069 GGTGTTCTCAGCGGAGTCCAGGG + Intergenic
924673165 1:246148925-246148947 GGAGTTCTCAGGTGAGTGGCAGG + Intronic
1062925511 10:1313142-1313164 GGAGTGCCCAGGTGAGTCCAGGG + Intronic
1063313884 10:4983168-4983190 TGCGCTCTCATGTGTGTGCAGGG - Exonic
1063335973 10:5213760-5213782 GGCTTTCTCACGTGTGTGCAGGG + Intronic
1064426154 10:15231491-15231513 CGCGTTCTCAGGGCTGTGCACGG - Intronic
1069557434 10:69407359-69407381 GCAGTTCCCAGGTGGGTGCAAGG - Intronic
1069801637 10:71085415-71085437 GGCTCTCTCAGGTGAGAGCTGGG + Intergenic
1073671236 10:105592617-105592639 GGAGTTCTTAAGTGAGTGAAGGG - Intergenic
1074047809 10:109854812-109854834 GGCCGTCTCAGCTGAGAGCAAGG - Intergenic
1075064908 10:119282739-119282761 GGAGTTGTCAGGAGAGTCCAGGG + Intronic
1081787074 11:45755400-45755422 GTCGTTTTCAGGTGGGCGCAGGG + Intergenic
1083772347 11:64875199-64875221 GGCAGTCTCAGTTGAGAGCAGGG + Intronic
1093945086 12:25099118-25099140 AGAGTCCTCAGGTGACTGCAAGG - Intronic
1096155503 12:49339342-49339364 GGGGGTCTCTGGTGAGTGGAGGG - Intergenic
1098024645 12:66189158-66189180 GCCGTTCTCCGGTCACTGCAGGG - Exonic
1100384300 12:94091542-94091564 GGCACTCTCAGCTGAGTGGAGGG + Intergenic
1103132105 12:118478438-118478460 GCAGCTCACAGGTGAGTGCAAGG - Intergenic
1105708299 13:22982222-22982244 GCCGTTCTCATTTGTGTGCATGG + Intergenic
1107827230 13:44339416-44339438 GGCTTTTCCATGTGAGTGCAAGG - Intergenic
1118794619 14:69129875-69129897 GGGGTTCTCAGATGAGTTGAAGG - Intronic
1123467775 15:20529159-20529181 GGCGGACTCAGGTGGGTGCTGGG - Intergenic
1123650338 15:22471883-22471905 GGCGGACTCAGGTGGGTGCTGGG + Intergenic
1123728088 15:23124368-23124390 GGCGGACTCAGGTGGGTGCTGGG - Intergenic
1123740746 15:23280725-23280747 GGCGGACTCAGGTGGGTGCTGGG + Intergenic
1123746252 15:23321833-23321855 GGCGGACTCAGGTGGGTGCTGGG - Intergenic
1124278519 15:28345150-28345172 GGCGGACTCAGGTGGGTGCTGGG - Intergenic
1124304181 15:28566458-28566480 GGCGGACTCAGGTGGGTGCTGGG + Intergenic
1129872815 15:78951922-78951944 GGTGTTTGCAGGTGGGTGCAAGG + Intergenic
1132613515 16:829144-829166 GGCCTTCCCAGGTGCGTGCCCGG - Intergenic
1135505257 16:23030935-23030957 GGAGTTCTGAGGTGGGTGAATGG - Intergenic
1138016921 16:53436588-53436610 GTCATTCTCATGGGAGTGCAAGG + Intronic
1140935547 16:79666343-79666365 GGCATTCTCAGGATTGTGCAAGG - Intergenic
1141436469 16:84002501-84002523 TGCCTTCTCAGGTGGGGGCAGGG - Exonic
1141657418 16:85423559-85423581 GGGGTTCCCATGTTAGTGCATGG - Intergenic
1148484346 17:47981134-47981156 GGGGCACTCAGGTGAGTGCTGGG - Intronic
1148640133 17:49181218-49181240 GGTGTTCACAGGTGTGGGCATGG + Intergenic
1148710574 17:49677921-49677943 GCCGCTCTCAGGTGAGTGGGGGG - Exonic
1152423765 17:80208092-80208114 GGCGGGCTCAGGGGAGAGCAAGG - Intronic
1157103771 18:44754026-44754048 GGCGATCTATGGTGAATGCAAGG - Intronic
1158109179 18:53920840-53920862 GGCATGCGCAGGTGCGTGCACGG + Intergenic
1159443835 18:68514825-68514847 GGAATTCTCAGGTGAATGCAGGG + Intergenic
1162152877 19:8657967-8657989 GGCGGTCTTGGGTGGGTGCAGGG + Intergenic
1164676347 19:30104212-30104234 GGGGTTGTCAGGTGAGGGAAAGG - Intergenic
925174025 2:1769889-1769911 GGAGAGCTCAGGTGAGTGCCTGG + Intergenic
925646819 2:6044588-6044610 GAAGTTGTCAGGTGAGGGCAGGG - Intergenic
928648249 2:33377883-33377905 GGAGTTCTCAGGAGAGTTGATGG - Intronic
937335189 2:121058279-121058301 GGCTTCCTTAGGTGGGTGCAGGG + Intergenic
937361488 2:121232965-121232987 GGGTTTCTCAGGTGAGGGAAAGG - Intronic
938173820 2:129106067-129106089 GGCATTCCTAGGTGTGTGCAGGG - Intergenic
938289062 2:130140011-130140033 AGCTTTCCCAGGTGAGTGCCTGG - Exonic
938341855 2:130541185-130541207 GGGGTTCCCAGGTGAGCGCGGGG + Intronic
938347975 2:130579526-130579548 GGGGTTCCCAGGTGAGCGCGGGG - Intronic
938467468 2:131532927-131532949 AGCTTTCCCAGGTGAGTGCCTGG + Exonic
940865773 2:158816631-158816653 GGCATTCTCAGGTGACAGCTGGG + Intronic
946771341 2:223092148-223092170 GGCTTTCTCACTTGGGTGCAGGG - Intronic
1171367024 20:24632140-24632162 GGCGGTGTCAGGAGAGGGCAGGG + Intronic
1172514327 20:35522661-35522683 GTGGTCCTCAGGTGGGTGCAGGG - Intergenic
1174282210 20:49447434-49447456 TGTGTTCTCAGGAGAGAGCAGGG - Intronic
1174552418 20:51371570-51371592 GGTGATCCCAGCTGAGTGCAGGG + Intergenic
1174875618 20:54223443-54223465 GGGGGTCTCAGGTGTGTGTAGGG - Intronic
1175521993 20:59607925-59607947 GAAATTCTCAGGTGAGTACAAGG - Intronic
1181125136 22:20697717-20697739 GGCGCCCTCAGGTGGCTGCATGG + Intergenic
1181330894 22:22089865-22089887 GGATTTCTCAGGTGAGTGCCTGG - Intergenic
1181882688 22:25993438-25993460 GGCCTGCTCAGGTGTGTACAGGG - Intronic
1182079826 22:27521117-27521139 GGAGGACTCAGGTGATTGCATGG - Intergenic
1182620152 22:31614406-31614428 GGAGATGTCAGGTGGGTGCATGG + Intronic
1183109313 22:35637477-35637499 GGGGTGCTCTGGTGAGAGCAAGG - Intronic
1183311284 22:37110948-37110970 GGCTTTCTAGGGTGCGTGCAGGG + Intergenic
949146029 3:701089-701111 GGGTTTCTCAGGTGATAGCAAGG + Intergenic
949332327 3:2936199-2936221 TGCTTTCCCAGGTGGGTGCATGG - Intronic
949526642 3:4911070-4911092 CACATCCTCAGGTGAGTGCATGG + Intergenic
954315047 3:49796561-49796583 GGCGTTGTCACCTGAGTTCAGGG - Intronic
954744426 3:52779036-52779058 GGCCTTGTCAGGTGAGTTCTGGG + Exonic
961009834 3:123428351-123428373 GGGATTTTCAGGTGACTGCAGGG - Intronic
968870765 4:3240990-3241012 GGCCTTCTCAGCTGAGTGACAGG - Exonic
968880253 4:3294922-3294944 GGAGTGCTCAGGAGAGGGCAGGG + Intronic
968976104 4:3822810-3822832 GGACTTCCCAGGTGGGTGCAGGG - Intergenic
982028643 4:151277214-151277236 GGGGATCTCAGGTGAGCGCCAGG + Exonic
982547114 4:156747738-156747760 GGCGATCTCAGCTCACTGCAAGG - Intergenic
983936896 4:173508602-173508624 AGACTTCTCAGGTGAGGGCAGGG + Intergenic
986643344 5:9892920-9892942 GTCACTCTCAGGAGAGTGCAGGG + Intergenic
989105281 5:37857264-37857286 GTCCATCTCAGGTCAGTGCAGGG - Intergenic
990740257 5:58905227-58905249 GGGATTCTCAGGTGAGTACCTGG - Intergenic
996023213 5:118614341-118614363 GGACTGCTCAGGTAAGTGCAGGG + Intergenic
997655422 5:135550742-135550764 GCGGGTGTCAGGTGAGTGCATGG - Intergenic
998576957 5:143327263-143327285 GGAGTTCTCAGGAGAGTTGATGG - Intronic
999563202 5:152827741-152827763 GCTGTTCTCACATGAGTGCAGGG + Intergenic
1000025838 5:157358483-157358505 GGAGATCTCTGCTGAGTGCATGG - Intronic
1002785794 6:398925-398947 GGCGTTCTCAGGTGAGTGCAGGG + Exonic
1008032872 6:46716870-46716892 GTCATTCTCAGGTGAGGGCAAGG + Intronic
1013396583 6:109746967-109746989 GGCTTACTCAGGTGGGTGAATGG + Intronic
1017329439 6:153178395-153178417 GGAGTTCTCAGGTGTTTGCCAGG + Intergenic
1018432846 6:163736444-163736466 GGGATTCTCAGGTCACTGCAAGG - Intergenic
1024293665 7:47826058-47826080 CAAGTTCACAGGTGAGTGCAAGG - Intronic
1026837345 7:73647734-73647756 CGCGTCATCAGGTGGGTGCAGGG - Intergenic
1027920224 7:84383567-84383589 TGCCTTCTCAGGTTAGTGAAGGG - Intronic
1031147633 7:118014569-118014591 GGAGTTCCCAGGTGAGGGCAAGG - Intergenic
1032640997 7:133768009-133768031 AGCCTTCTCAGATGAGTTCATGG - Intronic
1033660569 7:143399246-143399268 GGCATGCACAGGTGAGTCCAGGG - Exonic
1037526999 8:19735085-19735107 GGGGTTCTCAGTTCTGTGCATGG - Intronic
1045378585 8:101600430-101600452 GATGTTCTCAGGAGAGGGCAGGG - Intronic
1048203217 8:132394247-132394269 GGAGTTCTGAGGAGAGAGCATGG + Intronic
1052044965 9:23783459-23783481 GTTGTTTTCAGGTTAGTGCATGG - Intronic
1055000815 9:71447113-71447135 CGCCTTCTCTGGAGAGTGCAGGG + Intergenic
1061158917 9:128882240-128882262 GGCGAGCCCAGGTGAGTGGACGG + Intronic
1062500005 9:136848238-136848260 GGCGTTCCCAGGTGGGAGCCTGG + Exonic
1194034326 X:88852740-88852762 GTCTTTCTCAGGTGACTGCAGGG - Intergenic
1195208244 X:102625387-102625409 GAAGTGCTCAGGTGGGTGCAGGG + Intergenic