ID: 1002789185

View in Genome Browser
Species Human (GRCh38)
Location 6:425132-425154
Sequence CTCCCTGGTGTGCCTCCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002789180_1002789185 25 Left 1002789180 6:425084-425106 CCCCGCTGAGGCTTGTTAGGAAA No data
Right 1002789185 6:425132-425154 CTCCCTGGTGTGCCTCCGCCAGG No data
1002789182_1002789185 23 Left 1002789182 6:425086-425108 CCGCTGAGGCTTGTTAGGAAACA No data
Right 1002789185 6:425132-425154 CTCCCTGGTGTGCCTCCGCCAGG No data
1002789181_1002789185 24 Left 1002789181 6:425085-425107 CCCGCTGAGGCTTGTTAGGAAAC No data
Right 1002789185 6:425132-425154 CTCCCTGGTGTGCCTCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002789185 Original CRISPR CTCCCTGGTGTGCCTCCGCC AGG Intergenic
No off target data available for this crispr