ID: 1002790580

View in Genome Browser
Species Human (GRCh38)
Location 6:434768-434790
Sequence CTGGACACACAGGTGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790580_1002790588 -6 Left 1002790580 6:434768-434790 CCTCCCTCCACCTGTGTGTCCAG No data
Right 1002790588 6:434785-434807 GTCCAGAATTGGCGGGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790580 Original CRISPR CTGGACACACAGGTGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr