ID: 1002790740

View in Genome Browser
Species Human (GRCh38)
Location 6:435800-435822
Sequence GCCAGTTGGCCCGCAAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790740_1002790755 29 Left 1002790740 6:435800-435822 CCGGGACTTGCGGGCCAACTGGC No data
Right 1002790755 6:435852-435874 CGCCCACCCGGAACTCGCGCTGG 0: 119
1: 275
2: 784
3: 689
4: 391
1002790740_1002790743 -8 Left 1002790740 6:435800-435822 CCGGGACTTGCGGGCCAACTGGC No data
Right 1002790743 6:435815-435837 CAACTGGCCACTCCGAGTGCGGG No data
1002790740_1002790742 -9 Left 1002790740 6:435800-435822 CCGGGACTTGCGGGCCAACTGGC No data
Right 1002790742 6:435814-435836 CCAACTGGCCACTCCGAGTGCGG No data
1002790740_1002790744 -7 Left 1002790740 6:435800-435822 CCGGGACTTGCGGGCCAACTGGC No data
Right 1002790744 6:435816-435838 AACTGGCCACTCCGAGTGCGGGG No data
1002790740_1002790749 17 Left 1002790740 6:435800-435822 CCGGGACTTGCGGGCCAACTGGC No data
Right 1002790749 6:435840-435862 CCCCCGAGCCCACGCCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790740 Original CRISPR GCCAGTTGGCCCGCAAGTCC CGG (reversed) Intergenic
No off target data available for this crispr