ID: 1002790746

View in Genome Browser
Species Human (GRCh38)
Location 6:435827-435849
Sequence GGCTCGGGGGGCCCCGCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790746_1002790755 2 Left 1002790746 6:435827-435849 CCGAGTGCGGGGCCCCCCGAGCC No data
Right 1002790755 6:435852-435874 CGCCCACCCGGAACTCGCGCTGG 0: 119
1: 275
2: 784
3: 689
4: 391
1002790746_1002790762 27 Left 1002790746 6:435827-435849 CCGAGTGCGGGGCCCCCCGAGCC No data
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790746_1002790749 -10 Left 1002790746 6:435827-435849 CCGAGTGCGGGGCCCCCCGAGCC No data
Right 1002790749 6:435840-435862 CCCCCGAGCCCACGCCCACCCGG No data
1002790746_1002790763 28 Left 1002790746 6:435827-435849 CCGAGTGCGGGGCCCCCCGAGCC No data
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790746 Original CRISPR GGCTCGGGGGGCCCCGCACT CGG (reversed) Intergenic
No off target data available for this crispr