ID: 1002790747

View in Genome Browser
Species Human (GRCh38)
Location 6:435839-435861
Sequence CGGGTGGGCGTGGGCTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790747_1002790763 16 Left 1002790747 6:435839-435861 CCCCCCGAGCCCACGCCCACCCG No data
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499
1002790747_1002790762 15 Left 1002790747 6:435839-435861 CCCCCCGAGCCCACGCCCACCCG No data
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790747_1002790755 -10 Left 1002790747 6:435839-435861 CCCCCCGAGCCCACGCCCACCCG No data
Right 1002790755 6:435852-435874 CGCCCACCCGGAACTCGCGCTGG 0: 119
1: 275
2: 784
3: 689
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790747 Original CRISPR CGGGTGGGCGTGGGCTCGGG GGG (reversed) Intergenic
No off target data available for this crispr