ID: 1002790748

View in Genome Browser
Species Human (GRCh38)
Location 6:435840-435862
Sequence CCGGGTGGGCGTGGGCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2155
Summary {0: 86, 1: 601, 2: 586, 3: 370, 4: 512}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790748_1002790763 15 Left 1002790748 6:435840-435862 CCCCCGAGCCCACGCCCACCCGG 0: 86
1: 601
2: 586
3: 370
4: 512
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499
1002790748_1002790762 14 Left 1002790748 6:435840-435862 CCCCCGAGCCCACGCCCACCCGG 0: 86
1: 601
2: 586
3: 370
4: 512
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790748 Original CRISPR CCGGGTGGGCGTGGGCTCGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr