ID: 1002790751

View in Genome Browser
Species Human (GRCh38)
Location 6:435842-435864
Sequence TTCCGGGTGGGCGTGGGCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790751_1002790763 13 Left 1002790751 6:435842-435864 CCCGAGCCCACGCCCACCCGGAA No data
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499
1002790751_1002790762 12 Left 1002790751 6:435842-435864 CCCGAGCCCACGCCCACCCGGAA No data
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790751 Original CRISPR TTCCGGGTGGGCGTGGGCTC GGG (reversed) Intergenic
No off target data available for this crispr