ID: 1002790752

View in Genome Browser
Species Human (GRCh38)
Location 6:435843-435865
Sequence GTTCCGGGTGGGCGTGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2120
Summary {0: 615, 1: 639, 2: 402, 3: 209, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790752_1002790763 12 Left 1002790752 6:435843-435865 CCGAGCCCACGCCCACCCGGAAC 0: 615
1: 639
2: 402
3: 209
4: 255
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499
1002790752_1002790762 11 Left 1002790752 6:435843-435865 CCGAGCCCACGCCCACCCGGAAC 0: 615
1: 639
2: 402
3: 209
4: 255
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790752 Original CRISPR GTTCCGGGTGGGCGTGGGCT CGG (reversed) Intergenic
Too many off-targets to display for this crispr