ID: 1002790753

View in Genome Browser
Species Human (GRCh38)
Location 6:435848-435870
Sequence CGCGAGTTCCGGGTGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2172
Summary {0: 114, 1: 223, 2: 761, 3: 668, 4: 406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790753_1002790763 7 Left 1002790753 6:435848-435870 CCCACGCCCACCCGGAACTCGCG 0: 114
1: 223
2: 761
3: 668
4: 406
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499
1002790753_1002790762 6 Left 1002790753 6:435848-435870 CCCACGCCCACCCGGAACTCGCG 0: 114
1: 223
2: 761
3: 668
4: 406
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790753 Original CRISPR CGCGAGTTCCGGGTGGGCGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr