ID: 1002790754

View in Genome Browser
Species Human (GRCh38)
Location 6:435849-435871
Sequence GCGCGAGTTCCGGGTGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2244
Summary {0: 121, 1: 263, 2: 778, 3: 665, 4: 417}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790754_1002790763 6 Left 1002790754 6:435849-435871 CCACGCCCACCCGGAACTCGCGC 0: 121
1: 263
2: 778
3: 665
4: 417
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499
1002790754_1002790762 5 Left 1002790754 6:435849-435871 CCACGCCCACCCGGAACTCGCGC 0: 121
1: 263
2: 778
3: 665
4: 417
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790754 Original CRISPR GCGCGAGTTCCGGGTGGGCG TGG (reversed) Intergenic
Too many off-targets to display for this crispr