ID: 1002790756

View in Genome Browser
Species Human (GRCh38)
Location 6:435854-435876
Sequence GGCCAGCGCGAGTTCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2311
Summary {0: 142, 1: 328, 2: 906, 3: 662, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790756_1002790762 0 Left 1002790756 6:435854-435876 CCCACCCGGAACTCGCGCTGGCC 0: 142
1: 328
2: 906
3: 662
4: 273
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790756_1002790763 1 Left 1002790756 6:435854-435876 CCCACCCGGAACTCGCGCTGGCC 0: 142
1: 328
2: 906
3: 662
4: 273
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790756 Original CRISPR GGCCAGCGCGAGTTCCGGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr