ID: 1002790757

View in Genome Browser
Species Human (GRCh38)
Location 6:435855-435877
Sequence GGGCCAGCGCGAGTTCCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2315
Summary {0: 125, 1: 272, 2: 818, 3: 693, 4: 407}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790757_1002790762 -1 Left 1002790757 6:435855-435877 CCACCCGGAACTCGCGCTGGCCC 0: 125
1: 272
2: 818
3: 693
4: 407
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790757_1002790763 0 Left 1002790757 6:435855-435877 CCACCCGGAACTCGCGCTGGCCC 0: 125
1: 272
2: 818
3: 693
4: 407
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790757 Original CRISPR GGGCCAGCGCGAGTTCCGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr