ID: 1002790758

View in Genome Browser
Species Human (GRCh38)
Location 6:435858-435880
Sequence TGCGGGCCAGCGCGAGTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2092
Summary {0: 102, 1: 233, 2: 780, 3: 602, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790758_1002790763 -3 Left 1002790758 6:435858-435880 CCCGGAACTCGCGCTGGCCCGCA 0: 102
1: 233
2: 780
3: 602
4: 375
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499
1002790758_1002790762 -4 Left 1002790758 6:435858-435880 CCCGGAACTCGCGCTGGCCCGCA 0: 102
1: 233
2: 780
3: 602
4: 375
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790758 Original CRISPR TGCGGGCCAGCGCGAGTTCC GGG (reversed) Intergenic
Too many off-targets to display for this crispr