ID: 1002790759

View in Genome Browser
Species Human (GRCh38)
Location 6:435859-435881
Sequence TTGCGGGCCAGCGCGAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1776
Summary {0: 106, 1: 205, 2: 734, 3: 503, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790759_1002790762 -5 Left 1002790759 6:435859-435881 CCGGAACTCGCGCTGGCCCGCAA 0: 106
1: 205
2: 734
3: 503
4: 228
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790759_1002790763 -4 Left 1002790759 6:435859-435881 CCGGAACTCGCGCTGGCCCGCAA 0: 106
1: 205
2: 734
3: 503
4: 228
Right 1002790763 6:435878-435900 GCAAGCGCCGCGCACAGTCCGGG 0: 3
1: 17
2: 171
3: 423
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790759 Original CRISPR TTGCGGGCCAGCGCGAGTTC CGG (reversed) Intergenic
900959033 1:5907641-5907663 TTGATGGCCAGCGCGGGCTCTGG + Intronic
901601505 1:10426682-10426704 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
901783313 1:11608795-11608817 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
902032649 1:13434171-13434193 TTGTGGGCCAGCGTGAATCCCGG - Intergenic
902963986 1:19984774-19984796 TTGCAGGCCAGCGCAAGTTCCGG - Intergenic
903624577 1:24721562-24721584 CTTGCGGCCAGCGCGAGTTCCGG + Intergenic
904238904 1:29131400-29131422 TTGCCGGCCAGCGCGAGTTCCGG - Intergenic
905375601 1:37518289-37518311 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
905742862 1:40387890-40387912 TTGTGGGCCAGCTGGAGTTCCGG + Intronic
905761175 1:40559194-40559216 TGGCAGGCCAGCGCGAGTTCCGG - Intergenic
906056011 1:42917310-42917332 TAGCGGGCCAGCGTGAGTTCCGG - Intergenic
906083241 1:43107832-43107854 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
906563540 1:46778828-46778850 TTGTGGGCCAGCTGGAGTTCCGG - Intronic
907371172 1:54004546-54004568 TTGCAGGTCAGCGCAAGTTCCGG - Intergenic
907759526 1:57343729-57343751 TTGCGGGCCAGCGCGAGTTCTGG - Intronic
907889465 1:58623469-58623491 TCGCCGGCCAGCTGGAGTTCCGG + Intergenic
907980033 1:59472166-59472188 TTGCGGGCCAGCGTGAGTTCCGG + Intronic
908027784 1:59969987-59970009 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
908291306 1:62669927-62669949 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
908888560 1:68817758-68817780 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
909318062 1:74248230-74248252 TCGCAGGCCAGCGTGAGTTCTGG - Intronic
909318576 1:74253669-74253691 TTGCGGCCCAGCTAGAGTTCTGG - Intronic
909377103 1:74952370-74952392 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
909782311 1:79561847-79561869 TCGTGGGCCAGCACGAGTTCTGG - Intergenic
909904595 1:81178934-81178956 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
910334307 1:86110597-86110619 TCGCGAGCGAGCGCGAGTTCCGG + Intronic
910371812 1:86524128-86524150 TTGCAGGCCAGCGCCAGTTCTGG - Intergenic
910550254 1:88467094-88467116 TTGCAGGCCAGCTAGAGTTCCGG + Intergenic
910609783 1:89128367-89128389 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
910622681 1:89273648-89273670 TTGAGGGCCAGCGCGAGTTCTGG - Intergenic
910625591 1:89303141-89303163 TCGGGGACCAGCGTGAGTTCTGG - Intergenic
910685736 1:89914281-89914303 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
910693162 1:89984940-89984962 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
911001428 1:93170306-93170328 TTGCGGGCCAGCTCGAGTTCCGG + Intronic
911205900 1:95091428-95091450 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
911259630 1:95669950-95669972 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
911839279 1:102660335-102660357 TTGCGAGCCAGCTGGAGTTCCGG - Intergenic
911853918 1:102853813-102853835 GCTCGGGCCAGCGCCAGTTCCGG + Intergenic
911950848 1:104172365-104172387 TGGCCGGCCAGCGCACGTTCAGG + Intergenic
911954521 1:104217767-104217789 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
912058154 1:105631558-105631580 TTGCGGGCCAGCTGGGGTTCCGG - Intergenic
912166121 1:107044793-107044815 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
912312908 1:108641183-108641205 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
912315901 1:108667514-108667536 TTGCAGGCCAGCTGGAGTTCGGG + Intergenic
912538788 1:110396660-110396682 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
912819403 1:112854836-112854858 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
913161093 1:116146878-116146900 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
913178677 1:116298310-116298332 TCGCGGGCCAGAGCAAGTTCCGG - Intergenic
913470169 1:119179104-119179126 TTGCTGGCCAGTGAGAGTTCCGG + Intergenic
913486091 1:119333791-119333813 TTGCCGGCCAGCGCGAGTTCTGG + Intergenic
913692142 1:121289427-121289449 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
913987077 1:143575131-143575153 TTGGGGGCTAGCTGGAGTTCCGG + Intergenic
914145413 1:144990687-144990709 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
914203459 1:145506175-145506197 TTGCAGACCAGCCGGAGTTCAGG - Intergenic
914438470 1:147681089-147681111 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
914482581 1:148079329-148079351 TTGCAGACCAGCCGGAGTTCAGG - Intergenic
915104098 1:153521824-153521846 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
915242345 1:154532396-154532418 TTGCAGGACAGCTAGAGTTCTGG - Intronic
915260022 1:154670788-154670810 TTGCGGGCCATCTGGAGTTCCGG + Intergenic
915261192 1:154678075-154678097 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
915666137 1:157446603-157446625 TTGCGGGCCAGCTGGATTTCCGG - Intergenic
915767183 1:158374449-158374471 TTGCAGGCCAGCTGGGGTTCGGG - Intergenic
916219835 1:162433192-162433214 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
916910140 1:169337400-169337422 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
916939009 1:169661254-169661276 TTGTGGGCCTGCGCGAGTTCCGG + Intergenic
916960253 1:169882149-169882171 TTGTGGGCCAGCTGGAGTTCTGG + Intronic
917348894 1:174056695-174056717 TCGGGGGCCAGCGCGAGTTCTGG - Intergenic
917406247 1:174711160-174711182 TTGCGGGCCAGCGTGAGTTCCGG - Intronic
917578579 1:176349593-176349615 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
917860488 1:179138878-179138900 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
917933030 1:179837253-179837275 TTGCTGGCCAGCTGGAGTTCCGG - Intergenic
918154549 1:181832453-181832475 TTGTGGGACAGGGCGAGTTCTGG + Intergenic
918512035 1:185322004-185322026 TTGAGGGCCAGCGCGAGTTCCGG - Intergenic
918542733 1:185649250-185649272 TCGCGGGCCAGCGCAAGTTCGGG - Intergenic
918659787 1:187074139-187074161 TTGAGGGCCAGCTGGAGTTCCGG - Intergenic
918708914 1:187703658-187703680 TTGCGGGCAAGCTGGAGTTCCGG + Intergenic
918720804 1:187850239-187850261 TTGCGGGCCAGCCAGAGTTCCGG + Intergenic
918732323 1:188013606-188013628 TTCCGGGTCAGCTGGAGTTCCGG - Intergenic
918732327 1:188013623-188013645 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
918789943 1:188813125-188813147 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
918792070 1:188841497-188841519 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
918853240 1:189718620-189718642 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
918943006 1:191026317-191026339 TCGCAGGCCAGCCCGAGTTCTGG - Intergenic
918951982 1:191151463-191151485 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
918993865 1:191731852-191731874 TTGCAGGCCAGCGCGAGTTCCGG + Intergenic
919049817 1:192499383-192499405 TTGCGGGCCAGCGTGAGTTCCGG - Intergenic
919167981 1:193919235-193919257 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
919201381 1:194358592-194358614 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
919237010 1:194859104-194859126 TTGCGGGCCAGTTGGAGTTCCGG + Intergenic
919250817 1:195054359-195054381 TCGCGGGCCAGCACGAGTTCTGG + Intergenic
919297798 1:195723211-195723233 TTGTCTGCCAGTGCGAGTTCCGG - Intergenic
919419796 1:197355716-197355738 TTGCGGGGCTGCGTGAGTTCTGG - Intronic
920150198 1:203900274-203900296 TTGCAGGCCAGCTAGAGTTCCGG + Intergenic
920479466 1:206307775-206307797 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
920604893 1:207371719-207371741 TCGCAGACCAGCGCCAGTTCTGG - Intergenic
920731397 1:208488761-208488783 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
920756650 1:208739716-208739738 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
920878488 1:209858973-209858995 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
920882061 1:209889262-209889284 TTGCGGGCCAGCGCGAGTTCTGG - Intergenic
920883178 1:209899123-209899145 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
921396417 1:214673469-214673491 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
921897066 1:220412469-220412491 TTGTGGGCCAGCTGGAGTTCTGG + Intergenic
921903877 1:220476017-220476039 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
921983707 1:221285981-221286003 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
922056800 1:222049784-222049806 TTGAGGGCCAGCTGGAGTTCCGG + Intergenic
922166168 1:223117262-223117284 TCACGGGCCAGCGCGAATTCTGG - Intronic
922306999 1:224352807-224352829 TTGTGGGCCAGCGCGAGTTCTGG - Intergenic
922423181 1:225472744-225472766 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
922485396 1:225969807-225969829 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
922541940 1:226426613-226426635 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
922855763 1:228773743-228773765 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
922985845 1:229865496-229865518 TTGCCGGCCAGCTGGAGTTCTGG + Intergenic
923157263 1:231289798-231289820 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
923172624 1:231431096-231431118 TTGCGGGCCAGCACGCGTTCCGG - Intergenic
923193475 1:231642227-231642249 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
923324839 1:232871767-232871789 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
923353153 1:233129161-233129183 TTGTGGGCCAGCTAGAGTTCCGG + Intronic
923623253 1:235594704-235594726 TTGCGGACCAGCGTGAGTTCTGG - Intronic
924117491 1:240762528-240762550 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
924219266 1:241855900-241855922 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
924305917 1:242689465-242689487 TCACAGGCCAGCGTGAGTTCTGG + Intergenic
1063148985 10:3320150-3320172 TTGCGGGCCAGCTCGAGTTCTGG - Intergenic
1063300422 10:4845238-4845260 TTGCAGGCCAGCACGAATTCCGG - Intronic
1063309328 10:4937703-4937725 TTGCAGGCCAGCATGAGTTCCGG - Intronic
1063321066 10:5053423-5053445 TTGTGGGCCAGCACGAGTTCCGG - Intronic
1063769665 10:9183387-9183409 TTGCCGGCCAGCTGGAGTTCCGG + Intergenic
1064067685 10:12196475-12196497 TTGCGAGCCAGCGAGTGTGCTGG + Intronic
1064197759 10:13259643-13259665 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1064449241 10:15426398-15426420 TTGCAGGCCAGCACGAGTTCCGG - Intergenic
1064790386 10:18951600-18951622 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1065590289 10:27256517-27256539 TCGCGGGCCAGCGTGAGTTCCGG + Intergenic
1065743308 10:28815996-28816018 TTGCGAGCCAGCTGGAGTTCCGG - Intergenic
1065752196 10:28897099-28897121 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1065802580 10:29366232-29366254 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1065895868 10:30162892-30162914 TTGCCGGCCAGCGCGAGTTCTGG + Intergenic
1065965871 10:30769742-30769764 TCGCAGGCCAGCATGAGTTCCGG - Intergenic
1065981598 10:30903121-30903143 TTGTGGGCCAGCTAGAGTTCCGG - Intronic
1065995474 10:31055861-31055883 TTGGGGGCCAGCTAGAGTTCTGG + Intergenic
1066186273 10:33013329-33013351 TTGCGGGCCAGGTGGAGTTCCGG + Intergenic
1066190230 10:33049263-33049285 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1066234014 10:33468071-33468093 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1066235495 10:33480787-33480809 TTGCGGGCCAGGACGAGTTCCGG - Intergenic
1066296075 10:34055592-34055614 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1066567431 10:36734942-36734964 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1066568670 10:36748351-36748373 TTGCAGGCCAGTGTGAGTTCTGG + Intergenic
1066575453 10:36819969-36819991 TTCAGGGCCAGCGCAAGTTCGGG + Intergenic
1066598184 10:37076045-37076067 CTGCAGGCCAGCGCGAGTTCCGG + Intergenic
1066613630 10:37275647-37275669 TCGCAGGCCAGCATGAGTTCTGG - Intronic
1066660874 10:37737412-37737434 TTTGTGGCCAGCACGAGTTCTGG + Intergenic
1068211305 10:53924220-53924242 TCGCGAGCCAGCGTGAGTTCCGG + Intronic
1068373991 10:56155160-56155182 TTGCTGGCCAGCTGGAGTTCCGG + Intergenic
1068455511 10:57249877-57249899 TTGCGAGCCAGCTGGAGTTCTGG + Intergenic
1068820994 10:61377194-61377216 TTGAGGGTCAGCGCGAGTTCTGG - Intergenic
1068863139 10:61867682-61867704 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1068902084 10:62280415-62280437 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1068978107 10:63033626-63033648 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1069090841 10:64197094-64197116 TCGCGGGCCAGCGCGAGTTCCGG - Intergenic
1069186553 10:65429739-65429761 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1069215377 10:65812376-65812398 TTGCAGGCCAGCACGAGTTCCGG - Intergenic
1069992940 10:72325993-72326015 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1070564093 10:77590510-77590532 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
1070942587 10:80359812-80359834 TCGCAGGCCAGCGCAAGTTCCGG - Intronic
1070968283 10:80543286-80543308 ACCGGGGCCAGCGCGAGTTCCGG + Intronic
1070973356 10:80585915-80585937 TTGCGGGCCAGCTGGATTTCTGG + Intronic
1071003726 10:80859273-80859295 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1071037510 10:81265237-81265259 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1071041125 10:81309411-81309433 TGGCGGGCCAGGGCAAGTTCCGG - Intergenic
1071055675 10:81505864-81505886 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1071078693 10:81784256-81784278 TCGCGGGCCAGCGTGAGTTCTGG + Intergenic
1071085386 10:81863010-81863032 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1071611036 10:87031294-87031316 TCGCAGGCCAGTGCGAGTTCTGG - Intergenic
1071963809 10:90832498-90832520 TTGAGGGCCAGCTGGAGTTCCGG - Intronic
1072341879 10:94459820-94459842 TCACGGGCCAGTGCAAGTTCCGG - Intronic
1073532489 10:104245212-104245234 TTGCGGGCCAGCGCGAGTTCTGG + Intronic
1073789799 10:106928416-106928438 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1073878287 10:107950616-107950638 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
1074098101 10:110331496-110331518 TTGTGGGCCAGCACGAGTTCCGG + Intergenic
1074314563 10:112349780-112349802 TCGCTGGACAGCGTGAGTTCCGG + Intergenic
1074316982 10:112369825-112369847 TTGTGGGCCAGCGAGAGTTCCGG + Intergenic
1074317117 10:112370348-112370370 TTGCGGGCCAGCCCGAGTTCCGG + Intergenic
1074996375 10:118760470-118760492 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
1075255589 10:120923862-120923884 TTGCGGGCCAGCTGAAGTTCCGG + Intergenic
1075269406 10:121035662-121035684 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1075307604 10:121382200-121382222 TTGCGGGCCAACGCGAGTTCCGG + Intergenic
1075505035 10:123013826-123013848 TTGTGGGCCAGCTAGAGTTCCGG - Intronic
1076261689 10:129071675-129071697 TTGCCGGCCAGCTGGAGTTCCGG - Intergenic
1076706917 10:132307402-132307424 CTGCGGCCCCACGCGAGTTCTGG - Intronic
1076773584 10:132680699-132680721 TTGCGGGCCAGCTGGATTTCCGG + Intronic
1076796563 10:132801259-132801281 TTGCGGGCCAGCTGGATTTCCGG - Intergenic
1077583816 11:3435266-3435288 TTGCGGGCCAGCGCGAGTGCCGG - Intergenic
1077603218 11:3588765-3588787 TTGCTTGCCAGCTGGAGTTCTGG + Intergenic
1077764562 11:5144452-5144474 TTGCTGACCAGCGCGAGTTCCGG + Intergenic
1077805732 11:5589917-5589939 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1077815587 11:5682985-5683007 TTGTGGGCCAGCTGGAGTTCCGG + Intronic
1078251924 11:9623360-9623382 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1078301229 11:10133627-10133649 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1078743722 11:14091650-14091672 TTGCGAGCCAGCTGGAGTTCTGG - Intronic
1079191007 11:18276415-18276437 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1079555443 11:21753421-21753443 TTGCGGGGCAGCTGGAGTTCCGG - Intergenic
1079689093 11:23400233-23400255 TTGCGGGCTAGCGCGAGTTCCGG + Intergenic
1079726249 11:23883754-23883776 TTGAGGGCCCGCTGGAGTTCTGG - Intergenic
1079730593 11:23935047-23935069 TTGAGGGCCAGCTGGAGTTCTGG - Intergenic
1079731784 11:23942600-23942622 TTGCGGACCAGCTGGAGTTCTGG - Intergenic
1079756829 11:24274562-24274584 TTGCGGGCCAGCGCAAGTTCCGG - Intergenic
1079767811 11:24416342-24416364 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1079803143 11:24896325-24896347 TTGCGGGCCACAGTGAGTTCTGG + Intronic
1079867589 11:25756156-25756178 TTGCAGGCCAGTGTGAGTTCTGG + Intergenic
1080106050 11:28512654-28512676 TTACGGGCCAGCTGGAGTTCTGG - Intergenic
1080195226 11:29600469-29600491 TTGCAGGCCAGCTGGCGTTCCGG - Intergenic
1080204391 11:29712684-29712706 TTGCAGGCCAGCTAGAGTTCTGG + Intergenic
1080503107 11:32888491-32888513 TTGCGGGCCAGTGCCTGTTCTGG - Intergenic
1080557722 11:33432066-33432088 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1080621416 11:33990137-33990159 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1081046436 11:38278922-38278944 TCGCGGACCAGCGCGAGCTCTGG - Intergenic
1081047719 11:38296590-38296612 TCACAGGCCAGTGCGAGTTCCGG - Intergenic
1081115359 11:39192874-39192896 TTGCGGGCCAACGCGAGTTCCGG - Intergenic
1081125032 11:39311866-39311888 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1081136177 11:39442385-39442407 TTGCGGGCCAGGGGGAGTTCTGG - Intergenic
1081324493 11:41728406-41728428 TTGCTGGCCAGCTAGAGTTCCGG - Intergenic
1081420867 11:42873956-42873978 TTGCGGGCCAGCTGGAGTTGCGG + Intergenic
1081422040 11:42881421-42881443 TTGCAGGCCAGGTGGAGTTCTGG + Intergenic
1081428351 11:42949914-42949936 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
1082106704 11:48228948-48228970 TCATGGGCCAGCACGAGTTCTGG + Intergenic
1082270451 11:50164324-50164346 TTGCAGGCCAGCGCGAGTTCTGG - Intergenic
1082272087 11:50183310-50183332 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1082698790 11:56402242-56402264 TTGGGGGCCAACTGGAGTTCTGG - Intergenic
1082734894 11:56845235-56845257 TCGTGGGCCAGCACGAGTTCTGG + Intergenic
1082924607 11:58531987-58532009 TCGTGGGCCAGCACGAGTTTCGG + Intronic
1083074322 11:60020539-60020561 TTGCAGGCCAGCGCAAGTTCTGG - Intergenic
1083546082 11:63550243-63550265 TTGCTGGCCAGCTGGAGTTCCGG + Intergenic
1083886601 11:65576247-65576269 TGGCGGGCCAGCGGGAGCCCCGG + Exonic
1084024773 11:66441056-66441078 TTGCGGGCCAGCGCAAGTTCCGG - Intronic
1084107379 11:66988832-66988854 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1084186623 11:67476130-67476152 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1084210429 11:67619074-67619096 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1084240720 11:67817939-67817961 TTGCGGGCCAGCGCGAGTGCCGG - Intergenic
1085245572 11:75098244-75098266 TTGCAGGCCAGCTGGAGTTCTGG + Intergenic
1085253496 11:75159250-75159272 TTGCGGGCCAGCTCGGGCTGTGG + Intronic
1085375854 11:76060603-76060625 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1085447275 11:76609352-76609374 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1085863096 11:80257600-80257622 TTGCAGGCCAGCGTGAGTTCCGG + Intergenic
1085941097 11:81207633-81207655 TTGCGGGACAGCTAGAGTTCCGG + Intergenic
1085982830 11:81744849-81744871 TCCTGGGCCACCGCGAGTTCTGG - Intergenic
1086034877 11:82403938-82403960 TTCCGGGCCAGCGCGAGTTCCGG + Intergenic
1086043003 11:82501197-82501219 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1086087533 11:82970711-82970733 TTGCGTGCCAGCTAGAGTTCCGG + Intergenic
1086210149 11:84308858-84308880 TTGTGGGCCAGCGTGAGTTCCGG - Intronic
1086397777 11:86433844-86433866 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1086724619 11:90167227-90167249 TTGCGGCCCAGCGAGAGTTCCGG + Intronic
1086807984 11:91268794-91268816 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1087354510 11:97076638-97076660 TTGCAGGCCAGCTGGATTTCCGG + Intergenic
1087404902 11:97718058-97718080 TGGTGGGCCGGCGCGGGTTCCGG - Intergenic
1087486418 11:98763732-98763754 TTGCAGGCCAGCTGGAGTTCGGG - Intergenic
1087977289 11:104565257-104565279 TCGCGGGCCAGTGCGAGCTCCGG - Intergenic
1088481732 11:110301222-110301244 TTGTGGGCCAGCAGGAGTTCGGG - Intergenic
1088570846 11:111222016-111222038 TTGCGGGCCATCTGGAGTTCCGG + Intergenic
1089062149 11:115634216-115634238 TTGCGGGCCATCTGGAGTTCCGG - Intergenic
1089244764 11:117110773-117110795 TTGTGGGCCAGCTTGAGTTCTGG - Intergenic
1089367704 11:117931244-117931266 TTGGGGGTCTGGGCGAGTTCGGG + Intergenic
1089373603 11:117978810-117978832 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1089466433 11:118689296-118689318 TTGCGGGCCAGGTGGAGTTCCGG - Intergenic
1089666832 11:120025936-120025958 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1089800209 11:121021697-121021719 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1090133581 11:124171006-124171028 TTGCGGACCAGCGTGAGTTCCGG - Intergenic
1090229192 11:125089535-125089557 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1090307714 11:125705025-125705047 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1090588232 11:128237128-128237150 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1090776753 11:129972143-129972165 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
1090782697 11:130021710-130021732 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1090820547 11:130337682-130337704 TTGCGGGCCAGCGTGAGTTCCGG - Intergenic
1091201186 11:133782387-133782409 TTGTGGGCCAGCGCCAGTTCCGG + Intergenic
1091233484 11:134003185-134003207 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1091402273 12:188397-188419 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1092101716 12:5889170-5889192 TTGGGGGCCAGCGCGAGTTCTGG - Intronic
1092133935 12:6132656-6132678 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1092135173 12:6142234-6142256 TTGCGAGTCAGCTGGAGTTCCGG + Intergenic
1092137400 12:6159514-6159536 TTGCGGGCCAGCTGGAGTTCAGG + Intergenic
1092220268 12:6708347-6708369 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1092221370 12:6716074-6716096 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1092336644 12:7639878-7639900 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1092350552 12:7752396-7752418 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1092366519 12:7881316-7881338 TTGCGGGCCAGCACGAGTTCCGG + Intronic
1092471740 12:8787304-8787326 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1092472933 12:8794761-8794783 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1092572451 12:9739899-9739921 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1092617185 12:10225955-10225977 TTGCGCGCCAGCTGGAGTTCCGG - Intergenic
1092732442 12:11547330-11547352 TTCCGGGCCAGCGCGAGTTCCGG + Intergenic
1092868381 12:12784305-12784327 ATGTGGGCCAGCGCGAATTGGGG - Intronic
1093034463 12:14320133-14320155 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1093172331 12:15874667-15874689 TTGCGGGCCAGCGCGAGTTCTGG + Intronic
1093189368 12:16057420-16057442 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1093346242 12:18040292-18040314 TTGCAGGCCAGCATGAGTTCCGG + Intergenic
1093524803 12:20093589-20093611 TTGCGGGCCAGAGCAAGTTCTGG - Intergenic
1093527120 12:20115552-20115574 TTGTGGGCCAGCTGGAGTTCTGG - Intergenic
1093652520 12:21661567-21661589 TTGCGGGCCAGCTAGAGTTCCGG + Intronic
1093653970 12:21674374-21674396 TTGCGGGCCAACGCGAGTTCCGG - Intronic
1093715486 12:22376942-22376964 TTGCGGGTCAGCTAGAGTTCCGG + Intronic
1093793693 12:23285983-23286005 TTGTAGGCCAGCGCGAGTTCCGG + Intergenic
1093921636 12:24866114-24866136 TTGTGGGCCAGCTGGAGTTCCGG + Intronic
1093970182 12:25369404-25369426 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1093972929 12:25391466-25391488 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1094327533 12:29256681-29256703 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1094405383 12:30110771-30110793 TTGCAGGCCAGCGGGAGTTCCGG - Intergenic
1094409805 12:30156909-30156931 CTGCAGGCCAGCTGGAGTTCCGG + Intergenic
1094448688 12:30561671-30561693 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1094589332 12:31806111-31806133 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1094661251 12:32472329-32472351 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1094722032 12:33075383-33075405 TTGCAGGCCAGCGCGAGTTCCGG + Intergenic
1095123068 12:38441990-38442012 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1095444988 12:42274025-42274047 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1095478633 12:42611100-42611122 TGGTGGGCCAGCATGAGTTCTGG - Intergenic
1095533948 12:43224360-43224382 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1095587383 12:43863937-43863959 TTGCGGGCCAGCTAGAGTTCCGG + Intronic
1095642356 12:44500435-44500457 TTGCGGGCCACTGCGAGTTCTGG + Intergenic
1095776676 12:46018056-46018078 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1095901513 12:47333422-47333444 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1097017956 12:56000466-56000488 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1097128971 12:56796162-56796184 TTGCAGGCCAGCTGAAGTTCTGG - Intergenic
1097212917 12:57386350-57386372 TTGCGGGCCAGCACGAGTTCCGG + Intronic
1097253657 12:57655804-57655826 TCACGGGCCAACGCAAGTTCAGG + Intergenic
1097664218 12:62461556-62461578 TTGCGGGCCAGCTGGAATTCCGG - Intergenic
1097981987 12:65744397-65744419 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
1098168252 12:67719554-67719576 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1098498794 12:71166532-71166554 TTGCGGGCCAGCAAGAGTTCCGG - Intronic
1098515965 12:71376895-71376917 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1098588641 12:72185078-72185100 TTGCGGGCCAGCTGGAGTTCTGG + Intronic
1098759212 12:74402984-74403006 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1099190932 12:79561578-79561600 ACGCGGGCCAGCGTGAGTTCTGG + Intergenic
1099191364 12:79565006-79565028 TTGCGGGTCAGCTAGAGTTCTGG + Intergenic
1099192414 12:79573956-79573978 TTGCGAGCCAGCGCGAGTTCCGG + Intergenic
1099204324 12:79710975-79710997 TTGCGGGCCACCTGGAGTTCCGG + Intergenic
1099228193 12:79993547-79993569 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1099413734 12:82361740-82361762 TTGCTGGCCAGCGCGAGTTCCGG - Intronic
1099716258 12:86296715-86296737 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
1099790684 12:87330253-87330275 TTGCGGGCCAGCTGGAGTTCGGG + Intergenic
1100078893 12:90824100-90824122 TCGCGGGCCAGCGCGGGTTCCGG + Intergenic
1100142311 12:91633982-91634004 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1100584668 12:95969172-95969194 TTGCGGGCCACCTGGAGTTCCGG + Intergenic
1100600615 12:96108942-96108964 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1100734648 12:97513060-97513082 TTGCGGGCCTGCGCGAGTTCCGG - Intergenic
1101008958 12:100430339-100430361 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1101021593 12:100559419-100559441 TTGCAGGCCAGCTGGAATTCCGG + Intronic
1101461993 12:104905835-104905857 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1102903995 12:116660763-116660785 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1103239131 12:119398360-119398382 TCCCAGGCCAGCACGAGTTCCGG - Intronic
1103439264 12:120950663-120950685 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1103668513 12:122592062-122592084 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1103783426 12:123414436-123414458 TTGCGGGCCAGCTGGAGTTCCGG - Exonic
1103853259 12:123946985-123947007 TTGCAGGCCAGCTGGAGTTCTGG + Intronic
1104344462 12:127983419-127983441 TTGCGGACCAGCGAGAGTTCCGG + Intergenic
1104582607 12:130022092-130022114 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1104614549 12:130256977-130256999 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1104749207 12:131227849-131227871 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1105037721 12:132938791-132938813 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1105425612 13:20292454-20292476 TGCCGGGCCAGCTGGAGTTCCGG + Intergenic
1105593861 13:21817985-21818007 TCATGGGCCAGCGTGAGTTCTGG + Intergenic
1105605186 13:21920979-21921001 TTGTGGGCCAGCTAGAGTTCCGG - Intergenic
1105697249 13:22900727-22900749 TTGCGGGCCAATGCCAGTTCCGG - Intergenic
1105722148 13:23127609-23127631 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1105777659 13:23678126-23678148 TTGTGGGCCAGTACGCGTTCTGG - Intergenic
1105871173 13:24507129-24507151 TTGCGGGCCAGCGCAAGTTCCGG - Intronic
1105876716 13:24561028-24561050 TTGTGGGCCAGCTGGAGTTCTGG - Intergenic
1106221358 13:27748637-27748659 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1106600577 13:31183331-31183353 TTGCGGGCCAGCGCCAGTTCGGG - Intergenic
1106617096 13:31339989-31340011 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1106643459 13:31609149-31609171 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1106810918 13:33358018-33358040 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1107259411 13:38472753-38472775 TTGCGGGCCAGCTGGAGCTCCGG - Intergenic
1107652559 13:42559808-42559830 TTGCCGGCCAGCGCAAGTTCCGG + Intergenic
1107836082 13:44413613-44413635 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1108099209 13:46936377-46936399 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1108435309 13:50396632-50396654 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1108469487 13:50753628-50753650 TTGCGGGCCAGTGCGAGTTCCGG - Intronic
1108644008 13:52408398-52408420 TTGCGGGCCAGCACGAGTTCCGG - Intergenic
1108685486 13:52815539-52815561 TTGCGGGCCAGGGCGAGTTCCGG - Intergenic
1108751561 13:53452715-53452737 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1108851644 13:54737599-54737621 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1108856552 13:54800001-54800023 TTGCAGGCCAGCGCGAGTTCCGG - Intergenic
1108858988 13:54829823-54829845 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1108991169 13:56659432-56659454 TTGCAGGCCAGCGCGAGTTCTGG - Intergenic
1108995984 13:56735647-56735669 TTGCGGGCCGGCGCGAGTTCCGG + Intergenic
1109124730 13:58504549-58504571 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1109124951 13:58505743-58505765 TCACAGGCCAGCGTGAGTTCCGG - Intergenic
1109141016 13:58714121-58714143 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1109145379 13:58773355-58773377 TTGACGGCCAGCGTGAGTTCTGG + Intergenic
1109159903 13:58958505-58958527 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1109201840 13:59439948-59439970 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1109364607 13:61339205-61339227 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1109446642 13:62448221-62448243 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1109506124 13:63305785-63305807 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1109563189 13:64077817-64077839 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1109699677 13:66009428-66009450 TTGAGGGCCAGCGTGAGTGTGGG + Intergenic
1109741503 13:66561103-66561125 TTGTGAGCCAGCGCGAGTTCCGG + Intronic
1109745787 13:66621986-66622008 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1109829979 13:67773244-67773266 TTGCAGGCCAGCTCGAGTTCCGG - Intergenic
1110024099 13:70512228-70512250 TTGCGGACCAGCTGGAGTTCCGG - Intergenic
1110368835 13:74718429-74718451 TTGCAGGCCAGCTGGAGTTCTGG + Intergenic
1110417457 13:75268486-75268508 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1110434612 13:75465142-75465164 TTACGGCCCTGCGCAAGTTCTGG - Intronic
1110497832 13:76190142-76190164 TCGCGGGCCAGCGTGAGTTCCGG + Intergenic
1110609843 13:77475777-77475799 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
1110792427 13:79600481-79600503 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1110854231 13:80278942-80278964 TTGCAGGCCAGCACGAGTTCCGG - Intergenic
1110862102 13:80355584-80355606 TTGCGGACCAGCTGGAGTTCCGG + Intergenic
1110874398 13:80490884-80490906 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1110913960 13:80998751-80998773 TTGTGGGCCAGCGTGAGTTCTGG - Intergenic
1110940329 13:81341093-81341115 TTGCTGGCCAGCTGGAGTTCCGG - Intergenic
1110999873 13:82165273-82165295 TTGCGGGCCAGCTGGAATTCCGG - Intergenic
1111006612 13:82257997-82258019 TTGCGGGCCAGCTACCGTTCCGG + Intergenic
1111138812 13:84086699-84086721 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1111220877 13:85204951-85204973 TCGCGAGCCAGCGCGAGTTCTGG + Intergenic
1111333539 13:86792302-86792324 TCGCGGTCCAGCGCGAGTTCCGG + Intergenic
1111441875 13:88291857-88291879 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1111556202 13:89884149-89884171 TTGCGGGCCAGTGCGAGTTCCGG - Intergenic
1111590993 13:90348638-90348660 TTGCGGGCCAGCTGCAGTTCCGG + Intergenic
1111602702 13:90494857-90494879 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1111747657 13:92290926-92290948 TTGTGGGCCAGCGTGAGTTCTGG + Intronic
1111841445 13:93455108-93455130 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1112077786 13:95931759-95931781 TCATGGGCCAGCGCGAGTTCCGG - Intronic
1112518612 13:100077553-100077575 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1112533200 13:100224372-100224394 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1112613064 13:100975734-100975756 TTGCTGGCCAGCTGGAGTTCCGG + Intergenic
1112705823 13:102068512-102068534 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1112842671 13:103600019-103600041 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1113371984 13:109732977-109732999 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1113482716 13:110633352-110633374 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1113506608 13:110821197-110821219 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1113538165 13:111084195-111084217 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1113678025 13:112221754-112221776 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1114155521 14:20099236-20099258 TCGCGGGCCAGAGTGACTTCTGG + Intergenic
1114560340 14:23585205-23585227 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1114593504 14:23891794-23891816 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1114603268 14:23973307-23973329 TTGCAGGCCAGCACGAGTTCTGG - Intronic
1114608247 14:24015790-24015812 TTGCAGGCCAGCGCTAGTTCTGG - Intergenic
1114679550 14:24473187-24473209 TCGGGGGCCAGTGTGAGTTCCGG + Intergenic
1115174624 14:30547840-30547862 TGGCGGACCAATGCGAGTTCCGG - Intergenic
1115268662 14:31527408-31527430 TTGCGGGCCAGCGCGAGCTCCGG - Intronic
1115284223 14:31700583-31700605 TTGCAGGCCAGCGCGAGTTCCGG + Intronic
1115533262 14:34346122-34346144 TAGTGGGCCAGTGTGAGTTCTGG - Intronic
1116114527 14:40629961-40629983 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1116152159 14:41154562-41154584 CTCCCGGCCAGCGCGAGTTCCGG - Intergenic
1116223219 14:42113788-42113810 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1116251062 14:42482712-42482734 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1116325776 14:43533067-43533089 TCGCGGGCCAGCGCGAGTTCTGG + Intergenic
1116390498 14:44384780-44384802 TTGCGGGTCAGCTGGAGTTCCGG + Intergenic
1116426492 14:44798627-44798649 TTGCGAGCCAGCGCGAGTTCCGG + Intergenic
1116452328 14:45080474-45080496 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1116594352 14:46820472-46820494 TTGCGGGCCAACTAGAGTTCCGG + Intergenic
1116623985 14:47242481-47242503 TTGCGGGGCAGCTGGAGTTCCGG + Intronic
1116653746 14:47626595-47626617 TTGCGGGCCAGCGCGAGTTCCGG + Intronic
1116656931 14:47665569-47665591 TTGTGGGCCAGCTGGAGTTCCGG + Intronic
1117297542 14:54393492-54393514 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1117297756 14:54394670-54394692 TTGAGGGCCAGCGCGAGTTCTGG - Intergenic
1117302479 14:54443089-54443111 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1117446400 14:55807399-55807421 TTTCAGGCCCGGGCGAGTTCCGG + Intergenic
1117742596 14:58833957-58833979 TTGGGGGCCAGCGCCAGTTCCGG + Intergenic
1118215399 14:63803586-63803608 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1118558933 14:67057002-67057024 TTGCGGGCCAGCACGAGTTCTGG - Intronic
1118932337 14:70254758-70254780 TTGCCGGCCAGTGCGAGTTCCGG + Intergenic
1119027754 14:71167577-71167599 TTGCAGGCCAGCGCGAGTTCCGG + Intergenic
1119038809 14:71254333-71254355 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1119303703 14:73590756-73590778 TTGCGGGCCAGCGCGAGTCCCGG - Intergenic
1119486748 14:74994186-74994208 TTGTAGGCCAGCTGGAGTTCCGG + Intergenic
1119673481 14:76537073-76537095 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1119695078 14:76706987-76707009 TGGCGGGCCAGCCCGAGTTCCGG - Intergenic
1120209900 14:81624088-81624110 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1120429781 14:84399687-84399709 TTGCGGGCCAGCTCGAGTTCCGG - Intergenic
1120439142 14:84513231-84513253 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1120632338 14:86905753-86905775 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1120704807 14:87735083-87735105 TTGTGGGCCAGCTAGAATTCCGG - Intergenic
1120844131 14:89111685-89111707 TTGCGAGCCAGCTGGAGTTCCGG + Intergenic
1121350682 14:93170406-93170428 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1122216561 14:100208481-100208503 TTGCGGGCCAGATAGAGTTCCGG - Intergenic
1122493489 14:102135833-102135855 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1122514507 14:102297723-102297745 TTGCGGGCCAGCATGAGTTCTGG + Intronic
1122894848 14:104751808-104751830 TTGCGGGTCAGCGTGAGTTCCGG - Intergenic
1123051852 14:105547868-105547890 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
1123799109 15:23802951-23802973 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1123825598 15:24078754-24078776 TGGCGGGCCAGTGCGAGTTCTGG - Intergenic
1123949163 15:25253516-25253538 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1124023490 15:25944495-25944517 TGGCTGGCCAGCGCAGGTTCAGG - Intergenic
1124036342 15:26056950-26056972 TTGAGGGCCAGCGCGAGTTCCGG + Intergenic
1124110624 15:26781949-26781971 TTGCTGGCCAGCGTGAGTCCTGG - Intronic
1124114890 15:26831502-26831524 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1124198608 15:27656726-27656748 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1124387873 15:29225069-29225091 TTGCGGGCCAGCGTGAGTTCTGG - Intronic
1124573096 15:30883794-30883816 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1124759999 15:32440697-32440719 TTCCGGGCCACCGCTAGATCAGG + Intergenic
1125112183 15:36046992-36047014 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1125565783 15:40677250-40677272 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1125609671 15:40961655-40961677 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1126088961 15:45034872-45034894 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1126128044 15:45314130-45314152 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1126165558 15:45651327-45651349 TCGCGGGCCAGCACGAGTTCTGG - Intronic
1126639644 15:50812006-50812028 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
1126997552 15:54462493-54462515 TCGCGGGCCAGCGCCAGTTCTGG + Intronic
1127211551 15:56779657-56779679 TCGCGGGCCAGCTAGAGTTCTGG + Intronic
1127916410 15:63459104-63459126 TCGCTGGCCAGCGGGTGTTCCGG + Intergenic
1127984746 15:64060921-64060943 TTGCGGGCCAGCGCGAGTTCCGG + Intronic
1128141086 15:65301396-65301418 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1128594122 15:68929209-68929231 TTGCGGGCCAGCCCGAGTTCCGG - Intronic
1128598603 15:68975992-68976014 TTGTGGGCCAGCTGGAGTTCTGG - Intronic
1128670007 15:69567679-69567701 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1128813341 15:70587497-70587519 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1129158293 15:73732469-73732491 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
1129196906 15:73973786-73973808 TTGCTGGCCAGCGCGAGTTCCGG + Intergenic
1129208609 15:74052576-74052598 TTGTGGGCCAGCGCGAGTTCCGG + Intergenic
1129280425 15:74480667-74480689 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1129374033 15:75116269-75116291 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
1129724419 15:77894295-77894317 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
1129777530 15:78246460-78246482 TTGCAGGCCAGCTGTAGTTCCGG - Intergenic
1129986872 15:79926151-79926173 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1129997122 15:80016559-80016581 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1130132830 15:81158660-81158682 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1131005004 15:88970911-88970933 TCGCGGGCCAGCGCGAGTTCTGG - Intergenic
1131012733 15:89031976-89031998 TTGCAGGCCAGCGCGAGTTCCGG - Intergenic
1131212664 15:90510997-90511019 TTGCCGGCCAGCGTGAGTTCCGG + Intergenic
1131472854 15:92711340-92711362 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
1131507758 15:93031865-93031887 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
1131846152 15:96492160-96492182 TTGCGGACCAGCTGGAGTTCCGG - Intergenic
1131892199 15:96984432-96984454 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1131912561 15:97224285-97224307 TGGCGGGCCAGCGCGAGTTCCGG + Intergenic
1131992407 15:98104546-98104568 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1132044190 15:98549792-98549814 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
1132097679 15:99000087-99000109 TTGCGGGCCAGCGCGAATTCCGG + Intronic
1132098894 15:99008558-99008580 TTGCGCGCCAGTGCGAGTTCCGG - Intergenic
1132155855 15:99494931-99494953 TTGCGGGCCAGATAGAGTGCCGG - Intergenic
1132510986 16:341301-341323 TTGCAGGCCAGCTGGAGTCCCGG + Intronic
1133352185 16:5108833-5108855 TTGCGGGCCAGCGCGAGTGCCGG - Intergenic
1133362674 16:5186645-5186667 TTGCCGGCCAGTGTGAGTTCCGG - Intergenic
1134678163 16:16104949-16104971 TTGCGGGCCAGCGCTAGTTCTGG - Intronic
1135262155 16:20989963-20989985 TTGCAGGCCAGCTGGAGTTCCGG - Intronic
1135280818 16:21152635-21152657 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1135299422 16:21313103-21313125 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1135751100 16:25059233-25059255 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1135942718 16:26836377-26836399 TTGCAGGCCAGCGCGAGTTCCGG - Intergenic
1136356615 16:29748395-29748417 TCGAGGGCCAGCATGAGTTCCGG + Intergenic
1137442484 16:48508744-48508766 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1138168808 16:54829856-54829878 TCGCAGGCCAGCTAGAGTTCTGG + Intergenic
1139018990 16:62724905-62724927 TTGCTGGCCAGCGCGAGTTCCGG + Intergenic
1139051452 16:63129672-63129694 TTGTGGGCCAGCGCGAGTTCCGG + Intergenic
1139088546 16:63617457-63617479 TCGCGGGCCGGCACGGGTTCCGG - Intergenic
1139125568 16:64072650-64072672 TTGCGGGCCAGGTGGAGTTCGGG - Intergenic
1139147703 16:64343933-64343955 ATGCGGACCAGCTGGAGTTCCGG + Intergenic
1139442284 16:66974318-66974340 TTGCGGGCCAGAGTGAGTTCCGG + Exonic
1139600273 16:67982314-67982336 TTGCGGGCCAGCTCGAGTTCCGG + Intergenic
1139603018 16:67998253-67998275 TTGCGGGCCAGCTGGAGTTTCGG + Intronic
1139676396 16:68526786-68526808 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1139919618 16:70451118-70451140 TTGCGGGCCAGTACGAGTTCCGG - Intergenic
1141465767 16:84204904-84204926 TTGCGGACCAGCTGGAGTTCCGG - Intergenic
1141820357 16:86441535-86441557 GTGTGGGCCAGCTCGAGCTCAGG + Intergenic
1142505639 17:361631-361653 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1142768080 17:2076836-2076858 CTGCGGGCCAGCTGGAGTTGGGG - Intronic
1142828838 17:2532419-2532441 TTGCAGGCCAGCATGAGTTCCGG - Intergenic
1143128013 17:4656831-4656853 TTGCTGGCCAGCGTGAGTTCCGG - Intergenic
1143135289 17:4709363-4709385 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1143283331 17:5771282-5771304 TTGCGGGCCAGCGCGAATTCCGG + Intergenic
1143460536 17:7100878-7100900 TTGCGGGCCAGCGCGATTTCCGG - Intergenic
1143552721 17:7640935-7640957 TTGCCGGCCAGCGCGATTTTGGG + Intergenic
1143664307 17:8347442-8347464 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1144128055 17:12220943-12220965 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1144467125 17:15505735-15505757 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1144723184 17:17486391-17486413 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1144804692 17:17956793-17956815 TTGCGGGCCAGCGCGAGTTCTGG - Intronic
1146740499 17:35279236-35279258 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1147373592 17:40010971-40010993 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1147431791 17:40375866-40375888 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1147997501 17:44368861-44368883 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1148023350 17:44568255-44568277 TTGGGGGCCAGCGCGAGTTCTGG + Intergenic
1148366210 17:47057605-47057627 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1148991223 17:51668810-51668832 TCGTGGGCCAGCGCGAGTTCTGG + Intronic
1149753947 17:59172562-59172584 TTGCATGCCAGCTTGAGTTCTGG + Intronic
1150682484 17:67294788-67294810 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1150772250 17:68051911-68051933 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1150775794 17:68080695-68080717 TTGCCAGCCAGCGCGAGTTCCGG + Intergenic
1150778247 17:68099321-68099343 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1150786776 17:68169679-68169701 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1150804639 17:68309232-68309254 TTGTGGGCCAGCTGGAGTTCCGG - Intronic
1151782708 17:76257971-76257993 TTGCAGGCCAGCTGGAGTTCTGG - Intergenic
1151817179 17:76477102-76477124 TTGGGGGCCAGGGTGAGGTCTGG + Intronic
1151840673 17:76615232-76615254 TCGTGGGCCAGCGGGAGTGCTGG - Intergenic
1151866405 17:76806180-76806202 TTGCGGGCCAGGGCAAGTTCCGG + Intergenic
1152692032 17:81722644-81722666 TTGGGGGCCAGGGAGAGATCTGG + Intergenic
1153070348 18:1098264-1098286 TTGCAGGCCAACGCGAGTTCCGG + Intergenic
1153644088 18:7178988-7179010 TCGCGGGCCAGCTGGAGTTCCGG - Intergenic
1153832495 18:8935745-8935767 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1154057273 18:11023968-11023990 TTGCGGGCCAGCTGGAGTTACGG - Intronic
1154097634 18:11432613-11432635 TTCCGAGCCAGCACGAGTTCTGG - Intergenic
1154231179 18:12557466-12557488 TCGCGGGCCAGCATGAGTTCTGG - Intronic
1154231461 18:12559409-12559431 TCGCAGGCCAGCACGAGTTCCGG - Intronic
1154255348 18:12777176-12777198 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1154294140 18:13134991-13135013 TCGTGGGCCAGCACGCGTTCCGG - Intergenic
1154942979 18:21132778-21132800 TTGCAGGCCAGCTAGAGTTCCGG - Intergenic
1155003288 18:21706556-21706578 TCACGGGCCAGCGGGAGTTCCGG + Intronic
1155053962 18:22169586-22169608 CAGCGGGCGAGCGCGAGTCCGGG - Exonic
1155208083 18:23577953-23577975 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1155611742 18:27674185-27674207 TTGCCAGCCAGCTGGAGTTCCGG - Intergenic
1155772844 18:29723555-29723577 TTGCGGGACAGCTGGAGTTCCGG + Intergenic
1155806333 18:30175440-30175462 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1155852253 18:30788482-30788504 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1155856408 18:30839480-30839502 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1155976753 18:32139903-32139925 TTGCGGGCCAGCGTGAGTTCCGG + Intronic
1156038637 18:32794613-32794635 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1156119097 18:33820555-33820577 TCCCGGGCCGGCGCGGGTTCCGG - Intergenic
1156243076 18:35271969-35271991 AACCGTGCCAGCGCGAGTTCCGG - Intronic
1156610519 18:38718706-38718728 CTGTGGGCCAGCGCAAGTTCCGG - Intergenic
1156657798 18:39309131-39309153 TCGCGGGCCAGCATGAGTTGCGG + Intergenic
1156943143 18:42795286-42795308 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1156969643 18:43139560-43139582 TTACAGGCCAGCTAGAGTTCCGG + Intergenic
1157085938 18:44580771-44580793 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1157856928 18:51112127-51112149 TTGCAGGCCAGCGCAAGTTCCGG - Intergenic
1157858400 18:51121240-51121262 TTGCAGGCCAGCGTGAGTTCCGG - Intergenic
1157935210 18:51864692-51864714 TCGCGGGCCAGCGCGAGTTCCGG - Intergenic
1157979831 18:52367226-52367248 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1158266408 18:55664929-55664951 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1158351887 18:56572328-56572350 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1158460758 18:57643936-57643958 TTGCGGGCCAGCGTGAGTTCTGG - Intergenic
1158597363 18:58828003-58828025 TCGCGGGCCAGCATGAGTTCCGG - Intergenic
1158697293 18:59714414-59714436 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1158705785 18:59790773-59790795 TCGCGGGCCAGCTGGAGTTCCGG - Intergenic
1159167983 18:64725952-64725974 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1159230763 18:65605292-65605314 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1159260514 18:66006277-66006299 TTGCAGGCCAGTGCGAGTTCCGG - Intergenic
1159289292 18:66395860-66395882 AGGCGGGCCAGCGCGAGTTCCGG + Intergenic
1159322193 18:66866738-66866760 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1159472981 18:68880317-68880339 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1159743928 18:72209163-72209185 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1160176654 18:76600452-76600474 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1160198521 18:76777283-76777305 TTGCGGGCCGGCTGGACTTCTGG + Intergenic
1162091118 19:8280673-8280695 TCGTGGGACAGCGCGAGTTCCGG - Intronic
1162093352 19:8295511-8295533 TCGTGGGACAGCGCGAGTTCCGG - Intronic
1162106967 19:8375798-8375820 TTGTGGGCCAGCTGGAGTTCCGG + Intronic
1162230112 19:9259552-9259574 TTGCGGGCCCGCTGGAGTTCCGG + Intergenic
1162237617 19:9321436-9321458 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1162362819 19:10230174-10230196 GTGCGGGCCAGCACGGGGTCGGG - Intronic
1162632732 19:11941617-11941639 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
1162814762 19:13187031-13187053 TTGCGGGCCGGCTGGAGTTCCGG - Intergenic
1163181754 19:15608967-15608989 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1164144056 19:22499311-22499333 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1164270621 19:23668849-23668871 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1164310428 19:24041352-24041374 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1164695481 19:30240572-30240594 GTGCGGGCCAGTGGGAGGTCAGG - Intronic
1164975762 19:32571626-32571648 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1165846554 19:38821535-38821557 TCTCCGGCCAGCGCAAGTTCCGG + Intronic
1166036255 19:40170463-40170485 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1166487043 19:43222254-43222276 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1166649755 19:44563527-44563549 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1168659854 19:58157341-58157363 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
924967350 2:91030-91052 TTGTGGGCCAGCGTGAGTTCTGG + Intergenic
925099003 2:1229917-1229939 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
925172628 2:1759618-1759640 TCGCAGGCCAGCGCAAGTTCTGG - Intergenic
925537839 2:4935636-4935658 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
925609885 2:5693610-5693632 GTGCGGGCCGGCGCGACCTCGGG + Exonic
926097461 2:10091440-10091462 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
926097464 2:10091457-10091479 TTCCGGGTCAGCTAGAGTTCCGG + Intergenic
926437693 2:12854392-12854414 TGGCAGGCCAGCACGAGTTCTGG - Intergenic
926444559 2:12926832-12926854 CTGCGGGCCAGCGCGAGTTCCGG - Intergenic
926474800 2:13308613-13308635 TCGCGGGCCAGCGCGAGTTCCGG - Intergenic
926616666 2:15002857-15002879 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
926850638 2:17193592-17193614 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
927357051 2:22186381-22186403 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
927777776 2:25915539-25915561 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
927900401 2:26814508-26814530 CTGCGGGCCAGAGCGAGTTCCGG + Intergenic
927942218 2:27111789-27111811 TTGCCGGCCAGCGCGAGTTCCGG - Intronic
928106341 2:28472734-28472756 TTGTGGGCCAGCTAGAATTCTGG + Intronic
928493054 2:31803757-31803779 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
928599219 2:32886889-32886911 TCACTGGCCAGTGCGAGTTCTGG - Intergenic
928688530 2:33775385-33775407 TTGCAGGCCACTGCGAGTTCTGG + Intergenic
928753162 2:34494331-34494353 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
928793839 2:34992088-34992110 TCGCGGGCCAGCGCGGGTTCCGG + Intergenic
928936863 2:36688299-36688321 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
929070024 2:38020550-38020572 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
929109844 2:38397349-38397371 TTGCAGGCCAGCGCGAGTTCCGG + Intergenic
929201826 2:39244313-39244335 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
929233682 2:39585404-39585426 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
929890906 2:45917996-45918018 TAGCGGGCCAGCTAGAGTTCCGG - Intronic
930037982 2:47099770-47099792 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
930039179 2:47107318-47107340 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
930468246 2:51780608-51780630 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
930485474 2:52006837-52006859 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
930593371 2:53356472-53356494 TCGCAGGCCAGTGCAAGTTCTGG + Intergenic
931106941 2:59066966-59066988 TCGCGGGCTAGCGCAAGTTCCGG + Intergenic
931708661 2:64969042-64969064 TTGCGGGCCAGCTGGAGATACGG + Intergenic
932359550 2:71092809-71092831 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
932521744 2:72421866-72421888 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
932902017 2:75711613-75711635 CAGCGGGCCAGCTGGAGTTCCGG + Intergenic
932983500 2:76698442-76698464 TTGTGGGCCAGTGCGAATTCTGG - Intergenic
933442105 2:82326528-82326550 TTGCGGGCCAGCACGAGTTCCGG - Intergenic
933487290 2:82938767-82938789 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
933491074 2:82986007-82986029 CAGGGGGCCAGCGCGAGTTCCGG - Intergenic
933491084 2:82986042-82986064 TCTCCGGCCAGAGCGAGTTCTGG - Intergenic
933506299 2:83181081-83181103 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
933511496 2:83246248-83246270 TTGTGGGCCAGCGTGAGTTCCGG - Intergenic
933531607 2:83518208-83518230 TCGCGAGCCAGCGCGAGTTCCGG + Intergenic
933712172 2:85334673-85334695 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
934085097 2:88503176-88503198 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
934898462 2:98139041-98139063 TTGCAGGCCAGCTGGAGTTCCGG + Intronic
935866407 2:107392318-107392340 TTGTGGGCCAGCTGCAGTTCGGG + Intergenic
935896888 2:107747661-107747683 TTGCTGGCCAGCTGGAGTTCCGG - Intergenic
936172729 2:110190515-110190537 TTGTGGGCCAGCGTGAGTTCCGG - Intronic
936346853 2:111681888-111681910 TTCCGGGCCAGCTGGAGTTCCGG + Intergenic
936581557 2:113704727-113704749 TTGCGGGCCAGCGCGAGTTCTGG - Intergenic
937181107 2:119997021-119997043 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
937209627 2:120260073-120260095 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
937596820 2:123683811-123683833 TTGAGGGCCAGCTGGAGTTCTGG + Intergenic
937711881 2:124987733-124987755 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
937746568 2:125422284-125422306 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
938126111 2:128672447-128672469 TTGCGGGCCAGCTAGAGCTCCGG - Intergenic
938153160 2:128903841-128903863 TCGCGGGCCAGCGTGGGTTTGGG - Intergenic
938726062 2:134109671-134109693 TTGCGGGCCAGCTAGAGTTCTGG - Intergenic
938782007 2:134593168-134593190 TTCCAGGCCAGCTCAAGTTCTGG - Intronic
939053249 2:137331929-137331951 TTGTGGGCCAGCTGGAATTCCGG - Intronic
939178688 2:138780489-138780511 CTGCGGGGCAGCTCGAGCTCCGG + Intergenic
939229724 2:139410379-139410401 TTGCGGACCAGCTGGAGTTCCGG + Intergenic
939275240 2:139991021-139991043 TTGCGGGCCAGGGCGAGTTCCGG - Intergenic
939465095 2:142546099-142546121 TTGCGTGCCAGCTGGAGTTCCGG + Intergenic
939738813 2:145881231-145881253 TTGAGGGCCAGCTGGAGTTCAGG - Intergenic
939777384 2:146404014-146404036 TTGCGGACTAGCTGGAGTTCCGG - Intergenic
939886460 2:147686570-147686592 TCGCAGGCCAGTGCGAATTCTGG - Intergenic
939898879 2:147826899-147826921 TTGCGGGCCAGCCAGAGTTCCGG + Intergenic
940112677 2:150171349-150171371 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
940145817 2:150542866-150542888 TTGCGGGCCAGCTAGAATTCTGG - Intergenic
940215072 2:151296047-151296069 TTGCAGGACAGCGCGAGTTACGG + Intergenic
940361968 2:152805143-152805165 TCCTGGGCCAGCGCAAGTTCCGG - Intergenic
940666740 2:156618380-156618402 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
941178863 2:162234897-162234919 TTGCCGGCCAGCTAGAGTTCTGG + Intronic
941240050 2:163026313-163026335 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
941309218 2:163909560-163909582 TTGCGGGACAGCTACAGTTCCGG + Intergenic
941309753 2:163913652-163913674 GCGCGGGCCAGCTGGAGTTCCGG + Intergenic
941705904 2:168657761-168657783 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
941712155 2:168725220-168725242 TTGCAGGCCAGCTGGAGTTCCGG - Intronic
941820759 2:169841571-169841593 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
941878635 2:170459947-170459969 TTGAGAGCCAGCATGAGTTCCGG - Intronic
942170286 2:173282910-173282932 TTGCGGGCCAGCGTGAGTTCTGG - Intergenic
942317628 2:174709890-174709912 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
942368698 2:175257325-175257347 TCGCGCGCCAGCGCGAGTTCCGG - Intergenic
942540154 2:177007890-177007912 TTGCGGGCCAGCTGGAGTTTTGG + Intergenic
943024197 2:182608498-182608520 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
943106184 2:183546968-183546990 TTGCAGGCCAGCACGAGTTCCGG - Intergenic
943134406 2:183892572-183892594 TCACGGGCCAGTGTGAGTTCCGG + Intergenic
943166102 2:184327975-184327997 TTGCGGGCCAGTGCGAGTTCCGG - Intergenic
943365263 2:186962306-186962328 TCGCGGGCCAGAGTGAGTTCCGG + Intergenic
943494788 2:188606716-188606738 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
943680383 2:190761286-190761308 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
943790023 2:191921695-191921717 TTGCGGGCCAGCGCGAATTGCGG + Intergenic
943906149 2:193502731-193502753 TTCCCGGCCAGCACCAGTTCCGG - Intergenic
943954886 2:194176351-194176373 TTGCAGGCCAGCTAGAGTTCTGG + Intergenic
944055165 2:195515717-195515739 TTGCAGGCCAGCGCGAGTTCCGG + Intergenic
944058516 2:195547634-195547656 TTGCAGGCCAGCGCCAGCTCCGG - Intergenic
944228399 2:197370610-197370632 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
944482774 2:200174822-200174844 TTGCGGGCCAGCGCCAGTTCCGG + Intergenic
944728565 2:202496948-202496970 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
944729609 2:202503421-202503443 TTGCGGGCCAGCCGGAGTTCCGG + Intronic
944857965 2:203785896-203785918 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
945302592 2:208228006-208228028 TCATGGGCCAGTGCGAGTTCCGG - Intergenic
945401367 2:209387417-209387439 TTGAGAGCCAGCGCGAGTTCCGG + Intergenic
945575510 2:211524698-211524720 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
945664252 2:212721389-212721411 TCGCAGGCCAGCTCGAGTTCCGG - Intergenic
945745749 2:213718529-213718551 TTGCAGGCCAGCTGGAGTTCCGG + Intronic
945870186 2:215219096-215219118 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
945872859 2:215246051-215246073 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
945907922 2:215615208-215615230 TCGCTGGCCAGCGCAAGTTCCGG - Intergenic
946053965 2:216885287-216885309 TTGCGGGCCAGTGCGAGTTCCGG + Intergenic
946152798 2:217787578-217787600 TTGCGAGCCAGCGTGAGTTCTGG - Intergenic
946376477 2:219312858-219312880 TTGCGGGCTAGCGCGAGTTCCGG + Intergenic
946929115 2:224655336-224655358 TCATGGGCCAGCGCGAGTTCCGG + Intergenic
946982202 2:225229771-225229793 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
947026595 2:225744167-225744189 TTGCTGGCTAGCTGGAGTTCCGG + Intergenic
947103763 2:226648045-226648067 TTGCCGGCCAGCTAGAGTTCTGG + Intergenic
947411960 2:229850756-229850778 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
947539382 2:230964558-230964580 TGGCGGACCAGCGCGAGTTCCGG - Intergenic
947720389 2:232366378-232366400 TTGCGCGCCAGCTGGAGTTCCGG + Intergenic
947932092 2:233972790-233972812 TTGCGGGCCAGATGGAGTTCCGG - Intronic
947938051 2:234024604-234024626 TTGCGGGCCAACTAGAGTTCCGG - Intergenic
947962012 2:234247714-234247736 TGGCAGACCAGCACGAGTTCTGG + Intergenic
948449148 2:238058180-238058202 TTCTGGGCCAGCTGGAGTTCCGG - Intronic
948473609 2:238203028-238203050 TTCCGGGCCGGTGCAAGTTCAGG - Intronic
948820067 2:240538319-240538341 TCAGGGGCCAGCGCGAGTTCTGG + Intronic
1169645374 20:7803838-7803860 TTGCGGGTCAGCGCGAGTTCCGG - Intergenic
1169814487 20:9641911-9641933 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1169849163 20:10031719-10031741 TTGCGGGCCAGCTGGAGTTCTGG + Intronic
1170246436 20:14226546-14226568 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1170649471 20:18226803-18226825 TGGCGGGCCAGCTGGAGTTCCGG + Intergenic
1170806882 20:19639956-19639978 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1171318884 20:24221043-24221065 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1171973462 20:31578883-31578905 TTGCGGGCCAGCTAGAGTCCCGG - Intergenic
1173195558 20:40910792-40910814 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1173601564 20:44299171-44299193 TTGCGGGCTAGCTGGAGTTCCGG + Intergenic
1174092252 20:48058812-48058834 TTGTGGGCAAGCGTGAGTTCCGG + Intergenic
1174162912 20:48564385-48564407 TTGCCGGCCAGCGTGAGTTCCGG - Intergenic
1175210033 20:57348434-57348456 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1176189354 20:63800601-63800623 TTGCGGGCCAGCTAGAGTTCCGG + Intronic
1176344858 21:5733795-5733817 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1176351672 21:5854379-5854401 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1176499969 21:7590660-7590682 TTCCGGGCCAGCGCGAGTTCCGG + Intergenic
1176539179 21:8131865-8131887 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1176558130 21:8314910-8314932 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1176665118 21:9679102-9679124 TCGCGGGCCAGTGCTGGTTCCGG - Intergenic
1176671013 21:9735576-9735598 TTGTGGGCCAGCGCGAATTCTGG + Intergenic
1176966650 21:15218898-15218920 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1177182422 21:17757909-17757931 TTGCGGGCCAGTGCGAGTTCTGG - Intergenic
1177496898 21:21902455-21902477 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1177565861 21:22819162-22819184 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1177637585 21:23807055-23807077 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1177669678 21:24208993-24209015 TGGCGGGACAGCGCGAGTTCCGG - Intergenic
1177715993 21:24840405-24840427 TTGCAGGCCGGCGCGGGTTCCGG - Intergenic
1177795878 21:25778405-25778427 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1178054500 21:28783794-28783816 TCACGGGCCAGCACGAGTTCCGG + Intergenic
1178074150 21:29000214-29000236 TTGCGGACCAGCGTGAGTTCCGG + Intergenic
1178082241 21:29077440-29077462 TTGCGGGCCAGCGTGAGTTCCGG - Intergenic
1178398710 21:32265369-32265391 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1178585675 21:33868639-33868661 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1178983383 21:37283508-37283530 CTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1180741079 22:18053679-18053701 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1181077693 22:20392679-20392701 TTGCGGGCCAGCACGAGTTCCGG - Intergenic
1181450578 22:23017342-23017364 TTGCGGGCCAGTGCGGCTTCCGG - Intergenic
1182338053 22:29598344-29598366 TTGCGGGCCAGCGCGAATTGCGG - Intergenic
1182479355 22:30596899-30596921 TTGCGGGCCAGCTAGAGTTAAGG + Intronic
1183422158 22:37718162-37718184 TTGTGGGCCAGCTGGAGTTCCGG - Intronic
1183685181 22:39357575-39357597 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1183686983 22:39366867-39366889 TTGAGGGCCAGGGTGAGTTCAGG - Intronic
1183990330 22:41593564-41593586 TTGCGGGCCAGCTAGAGTTCTGG + Intergenic
1184069317 22:42138320-42138342 TCGCGGGCCAGCACCAGTTCTGG + Intergenic
1184584226 22:45436766-45436788 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1184906282 22:47488629-47488651 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1185229159 22:49670522-49670544 TCGAGGGCCGGCGCGAGTTCCGG - Intergenic
1203244127 22_KI270733v1_random:48220-48242 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
949133626 3:536086-536108 TAGCGGGCCGGCGTGGGTTCCGG - Intergenic
949281462 3:2352430-2352452 TCGCAGGCCAGCTGGAGTTCCGG + Intronic
949769962 3:7568636-7568658 TTGCGGGCCAGCTGGAGTTTTGG + Intronic
950068967 3:10136689-10136711 TTGTGGGCTAGCACAAGTTCCGG - Intergenic
950204881 3:11071545-11071567 TTGCAGGCCAGCACTAGTTCCGG - Intergenic
950207864 3:11094083-11094105 TTGTGGGTCAGCTAGAGTTCCGG + Intergenic
950256685 3:11511918-11511940 TTGCAGGCCAGCTGGAGTTCTGG - Intronic
950256994 3:11513565-11513587 TTGTGGGCCAGCTGGAGTTCCGG - Intronic
950418529 3:12882929-12882951 TTGGGGGCCAGCTAGAGTTCCGG + Intergenic
950470141 3:13179793-13179815 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
950513397 3:13447519-13447541 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
950600405 3:14029817-14029839 TTGCAGGCCAGCTGGAGTTCTGG - Intronic
950632611 3:14293245-14293267 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
950929367 3:16773755-16773777 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
951024889 3:17818007-17818029 TTGCGGGCCAGCTAGAGTTCCGG - Intronic
951024968 3:17818317-17818339 TTGCGGGCCAGCTAGAGTTCTGG - Intronic
951184943 3:19702609-19702631 TCGCGGGCCAGCGCGAGTTCCGG + Intergenic
951332974 3:21387532-21387554 TTGTGGGCCAGCATGAGTTCTGG - Intergenic
951415409 3:22416990-22417012 TTGCAGGCCAGCACGAGTTCTGG + Intergenic
951951121 3:28200735-28200757 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
952355356 3:32578792-32578814 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
952360438 3:32625677-32625699 TTGAGGGCCAGCTGGAGTTCCGG + Intergenic
952393679 3:32902832-32902854 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
952398201 3:32939721-32939743 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
952453665 3:33453487-33453509 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
952713286 3:36453383-36453405 TTGCGGGCCAGCGTGAGTTCCGG + Intronic
952730607 3:36633945-36633967 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
952795215 3:37233042-37233064 TTGCGGGTCAGCCGGAGTTCCGG + Intergenic
953002858 3:38951190-38951212 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
953089793 3:39713354-39713376 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
953124544 3:40078247-40078269 TTTCGGGCCAGCTGGAGTTCCGG - Intronic
953307638 3:41844487-41844509 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
953423003 3:42769751-42769773 TTGCCGGCCAGTGAGGGTTCTGG + Intronic
953674099 3:44986419-44986441 TTGCGGGCCAGCGCGAGTTCTGG - Intronic
953714571 3:45306707-45306729 TTCCCGGCCAGCTAGAGTTCTGG + Intergenic
954040976 3:47887244-47887266 TTGCGGGTCAGCTGGAGTTCCGG + Intronic
954089358 3:48272245-48272267 TCGCAGGCCAGCATGAGTTCCGG - Intronic
954226221 3:49182938-49182960 TTGCCGGCCAGCGTGAGTTCCGG - Intronic
954620091 3:51990595-51990617 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
955210257 3:56934504-56934526 TGGCGGGCCAGCTGGAGTTCCGG + Intronic
955219638 3:57012920-57012942 TCGCAGGCCAGCGTGAATTCCGG + Intronic
955449454 3:59050896-59050918 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
956183970 3:66544976-66544998 TTGCCGGCCAGTGCGAGTTCCGG - Intergenic
956195716 3:66651609-66651631 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
956438795 3:69260313-69260335 TGGCGAGTCAGCACGAGTTCCGG + Intronic
956479593 3:69660705-69660727 TAGCAGGCCAGCGCAAGTTCCGG + Intergenic
956481428 3:69677491-69677513 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
956563606 3:70611894-70611916 TTGTGGGCCAGCGCGAGTTCCGG + Intergenic
956632575 3:71331172-71331194 TTGTGGGCCAGCGCGAGTTCTGG + Intronic
956855228 3:73269231-73269253 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
956986941 3:74712095-74712117 TTGCGGACCAGCGGGAGTTCCGG + Intergenic
957002294 3:74900256-74900278 TTACGGGCCAGCGCGAGTTCCGG - Intergenic
957009217 3:74985448-74985470 TTGCGGGCCAGCTGTAGTTCTGG - Intergenic
957056187 3:75444736-75444758 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
957209460 3:77240406-77240428 TCGCAGGCCAGCGTGAGTTCCGG - Intronic
957277436 3:78108428-78108450 TTGCGGGCCAGATGGAGTTCCGG + Intergenic
957371453 3:79300257-79300279 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
957386421 3:79502295-79502317 TTGCGGGCCAGCGCGAGTTCCGG + Intronic
957419702 3:79951693-79951715 TTCTGGGCCAGCTGGAGTTCCGG - Intergenic
957446108 3:80314531-80314553 TTGTGGGCCAGCGTGAGTTTCGG + Intergenic
957556330 3:81767709-81767731 TTGCGCGCCAGCTGGAGTTCCGG - Intergenic
957630917 3:82715368-82715390 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
957665217 3:83217933-83217955 TTCCGGGCCAGCTGGAGTTCCGG - Intergenic
957804939 3:85134183-85134205 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
957830052 3:85504998-85505020 TTCCGGGCCAGCTGGAGTTCCGG - Intronic
957885474 3:86282287-86282309 TTGCGGGCCAGCTAGAGTTTCGG + Intergenic
957919685 3:86731750-86731772 TTGTGGGCCAGCGCGAGCATGGG - Intergenic
957921785 3:86757631-86757653 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
957970360 3:87375357-87375379 TCGCGGGCCAGCGCAAGCTCCGG + Intergenic
958022603 3:88015728-88015750 CTGCGGGCCAGCTGGAGTTCCGG + Intergenic
958810779 3:98858246-98858268 TTGCGGGCCAGTGCGAGTTCTGG - Intronic
960199433 3:114812976-114812998 TTGCGGGCAAGCGCGAGTCCCGG - Intronic
960227566 3:115185207-115185229 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
960282105 3:115791600-115791622 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
960479513 3:118171436-118171458 TCGTGGGCCACCGCGAGTTCCGG + Intergenic
960560071 3:119073723-119073745 TCACAGGCCAGCGCGAGTTCCGG - Intronic
960669174 3:120140288-120140310 TCTCAGGCCAGCGAGAGTTCCGG + Intergenic
960761703 3:121078876-121078898 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
960868613 3:122227498-122227520 TTGCGGGCCAGCACAAGTTCTGG - Intronic
961298203 3:125903971-125903993 TTGCGGGCCAGCGCGAGTGCCGG + Intergenic
961460431 3:127046715-127046737 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
961461987 3:127056429-127056451 TTGTGGGCCAGCTAGAGTTCCGG - Intergenic
961465070 3:127076563-127076585 TTGCGGGCCAGCCTGAGTTCTGG - Intergenic
961688765 3:128653433-128653455 TTGCGGGCCAGCTGGAGTTCTGG + Intronic
961700827 3:128743244-128743266 TCGCGGACCAGCGGGAGTTCCGG - Intronic
961746748 3:129068591-129068613 TTGCCGGCCAGCGCAAGTTCCGG - Intergenic
962177276 3:133167714-133167736 TCACGGGCCAGCGCAAGTTCCGG - Intronic
962283781 3:134070581-134070603 TTGCAGGCCAGCTGGAGTTCCGG - Intronic
962383796 3:134916682-134916704 TTGTGGGCCAGCGCCAGTTCCGG - Intronic
962398782 3:135039751-135039773 TTGCGGGCCAGCTTGAGTTCCGG - Intronic
962591105 3:136890322-136890344 TGGCGGGCCAGCTGGAGTTCCGG - Intronic
962600537 3:136987909-136987931 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
962671719 3:137714821-137714843 TTGTGGGCCAGCTAGAGTTCCGG - Intergenic
962758220 3:138484687-138484709 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
962998107 3:140651462-140651484 TTGTGGGCCAGCGTGAGTTCCGG + Intergenic
963397178 3:144749850-144749872 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
963440378 3:145333432-145333454 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
963509182 3:146225754-146225776 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
963533235 3:146497337-146497359 TTGCAGGCCAGCCCAAGTTCTGG + Intergenic
963651857 3:147989702-147989724 TTGCGAGCCAGCTCGAGTTCCGG - Intergenic
963673532 3:148280840-148280862 TTGCGGACTAGGGCAAGTTCCGG - Intergenic
963743034 3:149098172-149098194 TTGCCGGCCGGCGGGAGTTCCGG - Intergenic
963744131 3:149109426-149109448 TTGCAGGCCAGTGCGAGTTCTGG + Intergenic
963862134 3:150323006-150323028 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
964014340 3:151928193-151928215 TTGCGGGCCATCTGGAGTTCCGG + Intergenic
964032291 3:152152454-152152476 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
964118002 3:153156042-153156064 TTGAGGGCCAGCTGGAGTTCCGG - Intergenic
964129218 3:153268724-153268746 TTGCAAGCCAGCTCGAGTTCTGG + Intergenic
964139250 3:153378658-153378680 TTGCGGGCCAGCTGGCGTTCCGG - Intergenic
964198134 3:154088075-154088097 TTGTGGGCCAGCGCGAGTTCTGG + Intergenic
964265410 3:154889562-154889584 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
964375026 3:156041357-156041379 TTGTGGGCCAGCGCGAGTTCCGG + Intronic
964376234 3:156051816-156051838 TCGCAGGCCAGCACGAGTTCCGG + Intronic
964381072 3:156099506-156099528 TTGCGGTCCAGCGTGGGTTCCGG + Intronic
964393812 3:156224247-156224269 TTGCGGGCCAGCACGAGTTCCGG - Intronic
964443972 3:156740616-156740638 TTGCGCGCCAGCTGGAGTTCCGG + Intergenic
964452172 3:156822999-156823021 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
964802914 3:160574266-160574288 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
964974138 3:162599736-162599758 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
964983183 3:162710832-162710854 TTGCAGGCCAGCGTGAGTTCCGG - Intergenic
965003496 3:162987388-162987410 TTGCCGGCCAGCTGGAGTTCGGG + Intergenic
965040263 3:163499062-163499084 CTGCGGGCCAGCTGGAGTTCCGG + Intergenic
965044168 3:163552643-163552665 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
965200376 3:165649639-165649661 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
965220243 3:165918770-165918792 TTGCGGGCTAGCGCGAGTTCCGG - Intergenic
965220921 3:165924627-165924649 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
965245273 3:166258790-166258812 TTGCGAGCCAGCTGGAGTTCCGG - Intergenic
965256758 3:166424013-166424035 TTGCGGACCAGCGTGAGTTCTGG + Intergenic
965298098 3:166975872-166975894 TTGAGGGCCAGCTGGAGTTCCGG + Intergenic
965446446 3:168780178-168780200 TTAAGGGCCAGCGTGAGTTCCGG + Intergenic
965728550 3:171745927-171745949 TCACAGGCCAGCGCGAGTTCTGG + Intronic
965753264 3:171999193-171999215 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
965837336 3:172866819-172866841 TTGCGGGCCAGCTGGAGTTTCGG + Intergenic
965943516 3:174212294-174212316 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
966096827 3:176213750-176213772 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
966108242 3:176362545-176362567 TCTCGGGCCAGCGCAAGTTCCGG - Intergenic
966191050 3:177272049-177272071 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
966548987 3:181183309-181183331 TTGCGGGCCAGCGTGAGTTCCGG - Intergenic
966724971 3:183100935-183100957 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
966725467 3:183104068-183104090 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
967234131 3:187367891-187367913 TTGCAGGCCAGCTAGAGTTCTGG - Intergenic
967448472 3:189596162-189596184 TTCCGGGCCAGCTGGAGTTCCGG + Intergenic
967499185 3:190177371-190177393 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
967718315 3:192789070-192789092 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
968181629 3:196599359-196599381 TTGCGGGCCAGCTGGAATTCCGG - Intergenic
968412828 4:404281-404303 TTGCGGGCCAGTGTGAGTTCTGG - Intergenic
968469656 4:773600-773622 TTGCAGGCCAGCAAGAGTTCCGG + Intergenic
968716134 4:2161308-2161330 TTGCAGGCCAGCTGGAGTTCAGG + Intronic
968998997 4:3965015-3965037 TTGCAGGCCAGCGTGAGTTCCGG - Intergenic
969303187 4:6309347-6309369 TTGCGGGCCAGCGAGAGTTCCGG - Intergenic
969362324 4:6672762-6672784 TTGCGGGCCAGCTGGAGTTCAGG + Intergenic
969440710 4:7215167-7215189 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
969655005 4:8491731-8491753 TTGGGGGCCAGCTGGAGTTCCGG - Intronic
969755002 4:9143616-9143638 TTGCGGGCCAGCGCTAGTTCCGG + Intergenic
969814906 4:9679900-9679922 TTGTGGGTCAGCGCGAGTTCTGG + Intergenic
970108292 4:12609672-12609694 TTGCGGGCCAGCGAGAGTTCCGG + Intergenic
970182569 4:13415435-13415457 TTGCAGGCCAGTGCAAGTTCAGG + Intronic
970272096 4:14358702-14358724 TTGTGGGCCAGCGCGAGTTCCGG + Intergenic
970391185 4:15614952-15614974 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
970615788 4:17767128-17767150 TCGCGGGCCAGCGCGAGTTCCGG - Intronic
970649360 4:18159591-18159613 TTGCGAGCCAGCTGGAGTTCCGG - Intergenic
970673199 4:18418660-18418682 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
970692025 4:18630893-18630915 TCGCAGGCCAGCGTGAGTTCTGG - Intergenic
971043378 4:22778917-22778939 TCGCGGGCCAGCGCGAGTTCCGG - Intergenic
971280562 4:25239554-25239576 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
971377149 4:26064301-26064323 CTGCCGGCCAGCTGGAGTTCCGG - Intergenic
971553068 4:27978657-27978679 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
971564222 4:28117463-28117485 TTGCTGGCCAGCGCGAGTTCCGG - Intergenic
971635082 4:29047566-29047588 TTGCAGGCCAGCTAGAGTTCTGG + Intergenic
971639794 4:29117391-29117413 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
971811924 4:31438690-31438712 TTGCCGGACAGCTGGAGTTCCGG + Intergenic
971852066 4:31996427-31996449 TTGCGGGCCAACGCGAGTTCTGG + Intergenic
971905226 4:32716547-32716569 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
972022814 4:34335963-34335985 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
972034819 4:34506900-34506922 TTGCGGGCCAGCGTGAGTTCTGG - Intergenic
972392524 4:38626943-38626965 TTGCAGGCCAGCTGGAGTTCTGG + Intergenic
972778583 4:42265978-42266000 TTGCAGGCCAGTGCGAGTTCCGG + Intergenic
972900097 4:43672396-43672418 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
973037071 4:45420201-45420223 CTGTGGGCCAGCTGGAGTTCCGG + Intergenic
973041831 4:45477672-45477694 TTTCGGGCCAGCGTGGGTTCCGG - Intergenic
973048545 4:45567094-45567116 CTGTGGGCCAGCGCAAGTTCTGG + Intergenic
973144284 4:46805114-46805136 TTGGAGGCCAGCGCGAGTTCTGG - Intronic
973146283 4:46831077-46831099 TTGCAGGCCAGCTAGAGTTCCGG + Intronic
973190343 4:47378376-47378398 TTGCGGGCCAGCACGAGTTCCGG - Intronic
973308051 4:48675379-48675401 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
973587789 4:52410067-52410089 TTGCAGGCTAGCTGGAGTTCCGG - Intergenic
973764337 4:54149621-54149643 TCGCCGGCCAGCGCGAGTTCCGG - Intronic
973765125 4:54155445-54155467 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
973817550 4:54632575-54632597 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
973878092 4:55241540-55241562 TTGCTGCCCAGCGCAAGTTCCGG + Intergenic
974089912 4:57300491-57300513 TTGCGGGCCAGCATGAGTTCCGG - Intergenic
974147388 4:57965463-57965485 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
974186764 4:58456970-58456992 TCGCAGGCCGGCGCAAGTTCTGG + Intergenic
974590624 4:63943196-63943218 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
974781777 4:66561803-66561825 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
974792798 4:66712735-66712757 TTGCAGGCCAACTGGAGTTCCGG - Intergenic
974804353 4:66860207-66860229 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
974838256 4:67275566-67275588 TCGTGGGCCAGTGCGAGTTCCGG - Intergenic
974892325 4:67896882-67896904 TTGCCGGCCAGCTAGAGTTCCGG - Intergenic
974992904 4:69115565-69115587 TTGTGGGCCAGCTGGAGTTCCGG - Intronic
975055374 4:69923930-69923952 TTGCAGGCCAGCTGCAGTTCCGG + Intergenic
975160676 4:71120966-71120988 TCGCGGGCCAGCACGAGTTCCGG + Intergenic
975308526 4:72877146-72877168 TTGCGGGCCAGTGCTAGTTCCGG + Intergenic
975439982 4:74399385-74399407 TTGCTGGCCAGCACAAGTTCCGG - Intergenic
975595217 4:76043608-76043630 TTGTGGGCCAGCTGGAGTTCTGG - Intronic
975596397 4:76050979-76051001 TTGCAGGCCAGCTGGAGTTCCGG - Intronic
975754796 4:77561926-77561948 TTGTGGGCCAGCACAAGTTCTGG + Intronic
975755844 4:77570703-77570725 TTGTGGGCCAGCTGGAGTTCTGG + Intronic
975898403 4:79121971-79121993 TCGCGGGCCAGCACGAGTTCCGG + Intergenic
976102469 4:81580489-81580511 GTGTGGGCCAGTGCCAGTTCTGG + Intronic
976646896 4:87396268-87396290 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
976690634 4:87863988-87864010 TTGCAGGCCAGCGCGAGTTCTGG - Intergenic
976736314 4:88313467-88313489 TTGTGGGCCAGCGCGAGTTCTGG - Intergenic
976980327 4:91218291-91218313 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
977206487 4:94169883-94169905 TCGCGGGCCAGCTGGAGTTCTGG + Intergenic
977416636 4:96742557-96742579 TGGCAGACCAGTGCGAGTTCCGG + Intergenic
977470733 4:97438407-97438429 TTGAGGGCCAGCATGAGTTCCGG - Intronic
977717380 4:100196842-100196864 TTGGGGGCCAGCTGGAGTTCCGG - Intergenic
977750995 4:100609087-100609109 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
977883571 4:102234377-102234399 TTGCGGGCAAGTGTGAGTTCCGG + Intergenic
977885132 4:102245081-102245103 TCACAGGCCAGCGTGAGTTCCGG + Intergenic
978080220 4:104582021-104582043 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
978241917 4:106525665-106525687 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
978254913 4:106681776-106681798 TTGTGGGTCAGCGCAAGTTCTGG - Intergenic
978285500 4:107073136-107073158 TTGCAGGCCAGCGTGAGTTCGGG + Intronic
978463642 4:108984674-108984696 TTGCGGGCCAGCGGGAGTTCCGG - Intronic
978514577 4:109557446-109557468 TTGCGGGACAGCGCGAGTTCCGG + Intergenic
978886520 4:113772369-113772391 TCACGGGCCAGCATGAGTTCCGG + Intergenic
978918006 4:114148879-114148901 TTGCGGGCCAGTGCGAGTTCCGG - Intergenic
978998077 4:115179738-115179760 TTGTGGGCCAGCTGGGGTTCCGG - Intergenic
978999604 4:115200516-115200538 CCGCGGGCCAGCTGGAGTTCCGG - Intergenic
979224155 4:118265587-118265609 TTGCGCGCCAGCGCGAGTTCCGG + Intergenic
979290849 4:118977371-118977393 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
979308289 4:119173824-119173846 TTGCTGGCCAGCTGGAGTTCTGG + Intronic
979424780 4:120551059-120551081 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
979688555 4:123537955-123537977 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
979755841 4:124339092-124339114 TTGCGAGCCAGCGCGAGTTCCGG + Intergenic
979822532 4:125191989-125192011 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
979825737 4:125229913-125229935 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
979865188 4:125745030-125745052 TCATGGGCCAGCGCGAGTTCTGG + Intergenic
979899741 4:126201612-126201634 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
979920430 4:126490049-126490071 TTCCAGGCCAGCGCGAGTTCTGG + Intergenic
979991434 4:127379973-127379995 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
980051965 4:128047880-128047902 TTGCGGGCCAACTGGAGTTCCGG - Intergenic
980115190 4:128672701-128672723 TTGTGGGCCAGCGTGAGTTCCGG + Intergenic
980227947 4:130012819-130012841 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
980230282 4:130038864-130038886 TTGCGAGCCAGCTGGAGTTCCGG - Intergenic
980470258 4:133240730-133240752 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
980628565 4:135406657-135406679 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
980698722 4:136395386-136395408 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
980739241 4:136929048-136929070 TTGTGGGCTAGCGGGAGTTCTGG + Intergenic
980774461 4:137421059-137421081 TTGCAGGCCAGCTAGAGTTCTGG + Intergenic
980799733 4:137733775-137733797 TTGCCGGCCAGCTGGAGTTCTGG + Intergenic
980809217 4:137853645-137853667 TTGCAGGCCGGCGCGGGTTCCGG + Intergenic
980824134 4:138053222-138053244 TTGCGGGCCAGCACGAGTTCAGG - Intergenic
980865884 4:138553182-138553204 TCGTGGGCCAGCGCGAGTTGCGG + Intergenic
981136168 4:141213572-141213594 TCACGGGCCAGTGCAAGTTCTGG + Intergenic
981146805 4:141333515-141333537 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
981169593 4:141605714-141605736 TTGCGGGCCAGTTAGAGTTCTGG - Intergenic
981275791 4:142897538-142897560 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
982647648 4:158044209-158044231 TTGCGGTGCAGCTAGAGTTCCGG + Intergenic
982679067 4:158408106-158408128 TTGCGAGCCAGCTGGAGTTCCGG + Intronic
982692750 4:158566982-158567004 TTGCAGGCCAGCGCCAGTTCCGG + Intronic
982768907 4:159378136-159378158 TTGCCGGCCAGGGTGAGTTCCGG + Intergenic
982814614 4:159869356-159869378 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
982863355 4:160481808-160481830 TTGTGGGCCAGCGCGAGTTTCGG + Intergenic
982868841 4:160550439-160550461 TTGCGGGCCAGCTGGAATTCCGG - Intergenic
982921235 4:161277281-161277303 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
982985730 4:162203627-162203649 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
983026066 4:162739579-162739601 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
983060308 4:163152884-163152906 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
983064114 4:163190027-163190049 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
983134922 4:164068434-164068456 TTGTGGGCCAGCATGAGTTCTGG + Intronic
983230688 4:165126259-165126281 TTGCGGGCCAGCTGGAGTTCGGG - Intronic
983369795 4:166843138-166843160 TCGCGGGCCAGTGCTTGTTCTGG - Intronic
983425674 4:167581598-167581620 TCACGGGCCAGGGCGAGTTCTGG + Intergenic
983553086 4:169036157-169036179 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
983656708 4:170091268-170091290 TTGCGAGCCAGCTAGAGTTCCGG + Intronic
983752813 4:171298313-171298335 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
983835421 4:172377858-172377880 TCGCGGGCCAGCGTGAATTCTGG - Intronic
983843213 4:172482194-172482216 TCCTGGGCCAGCGCGAGTTCCGG - Intronic
984192869 4:176625485-176625507 TTGTGGACCAGCTGGAGTTCCGG - Intergenic
984238850 4:177193516-177193538 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
984241857 4:177227848-177227870 TTGCGGGCCAGCGCGAGTTCGGG - Intergenic
984265623 4:177495631-177495653 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
984662219 4:182386599-182386621 TTGCGGGCCAGCTGTAGTTCCGG + Intronic
984728633 4:183045115-183045137 TTGCGGACCAGTGCGAGTTCAGG + Intergenic
984770540 4:183433213-183433235 TTGCGGGCCACCTGGAGTTCCGG + Intergenic
984776136 4:183482985-183483007 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
984918073 4:184741244-184741266 TCGCGGGCCAGTGTGTGTTCCGG + Intergenic
984948754 4:184990410-184990432 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
985087067 4:186324623-186324645 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
985145403 4:186890153-186890175 CTGCGGGCCAGCACGAGTTCCGG + Intergenic
985195205 4:187421270-187421292 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
985203220 4:187505669-187505691 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
985324681 4:188754537-188754559 TCATGGGCCAGCGTGAGTTCTGG + Intergenic
985337292 4:188910422-188910444 TTGTGGGCCAGAGATAGTTCAGG + Intergenic
985366369 4:189236346-189236368 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
985403630 4:189615539-189615561 CTGCGGGCCAGTGCCAGTTGCGG - Intergenic
985403901 4:189616967-189616989 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
985410597 4:189679570-189679592 TCGCGGGCCAGTGCTGGTTCCGG - Intergenic
986121103 5:4837578-4837600 TTGCGGGCCAGCGTGAGTTCTGG + Intergenic
986151971 5:5137824-5137846 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
986626135 5:9725347-9725369 TTGTGGGCCAGTGGGAGTTCTGG + Intergenic
986661710 5:10065519-10065541 TTGCGGGCCAGTGCAAGTTCCGG + Intergenic
986697966 5:10375197-10375219 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
986912419 5:12574266-12574288 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
986912563 5:12574796-12574818 TTCCGGGCCAGCGTGAGTTCCGG - Intergenic
986993250 5:13578550-13578572 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
987146282 5:14994127-14994149 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
987156820 5:15096877-15096899 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
987283700 5:16436221-16436243 TTGCAGGCCAGCACGAGTTCCGG + Intergenic
987315265 5:16717990-16718012 TTGCGGGCCAGCTGGAGTTGCGG + Intronic
987355830 5:17062271-17062293 CTGAGAGCCAGCGCGAGTTCAGG + Intergenic
987365013 5:17140967-17140989 TTGCGGGCCAGCGGGAGTTCCGG + Intronic
987384044 5:17312094-17312116 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
987476728 5:18399993-18400015 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
987532817 5:19143092-19143114 TTGCCGGCCAGCTGGAGTTCCGG - Intergenic
987543797 5:19287783-19287805 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
987876921 5:23691163-23691185 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
987990274 5:25200344-25200366 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
988073458 5:26324460-26324482 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
988087019 5:26485601-26485623 TTGCGGGCCAGTTGGAGTTCCGG - Intergenic
988132127 5:27119936-27119958 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
988155086 5:27439772-27439794 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
988177233 5:27743500-27743522 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
988201805 5:28077974-28077996 TTGTGAGCCAGCGTGAGCTCTGG - Intergenic
988279584 5:29127944-29127966 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
988291779 5:29296760-29296782 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
988369210 5:30345767-30345789 TTGCCGGCCAGCACGAGTTCCGG + Intergenic
988500104 5:31777142-31777164 TCGCGGGGCAGCGTGAGTTCCGG + Intronic
988684766 5:33515708-33515730 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
988915926 5:35893189-35893211 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
989346768 5:40438698-40438720 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
989750273 5:44884234-44884256 TCCTGGGCCAGCACGAGTTCCGG - Intergenic
989777356 5:45225672-45225694 TCCCAGGCCAGCGTGAGTTCCGG + Intergenic
989950550 5:50292890-50292912 TTGAAGGCCAGCGCGAATTCTGG + Intergenic
989956817 5:50369477-50369499 TTGCAGGCCAGCTGGAGTTCTGG + Intergenic
989957900 5:50376871-50376893 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
989965799 5:50465053-50465075 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
990243230 5:53837010-53837032 TTGCGGGCCAGCGTGAGTTCTGG + Intergenic
990345231 5:54865116-54865138 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
990418938 5:55613390-55613412 CCACGGGCCAGCGCGAGTTCTGG + Intergenic
990461494 5:56035528-56035550 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
990490048 5:56295391-56295413 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
990512179 5:56498979-56499001 TTGCGGGCCAGCACAAGTTCCGG - Intergenic
990665741 5:58069432-58069454 TCGCGGGCCAACACAAGTTCCGG - Intergenic
990869448 5:60415496-60415518 TTGAAGGCCAGTGCGAGTTCCGG + Intronic
991214917 5:64150119-64150141 CTGTGGGCCAGCTAGAGTTCCGG + Intergenic
991330255 5:65485753-65485775 TTGCAGGCCAGTGCGAGTTCCGG - Intergenic
991427072 5:66503329-66503351 TTGCGGGACAGCGCGAGTTCCGG + Intergenic
991505394 5:67318901-67318923 TCGCAGGCCAGCGCAAGTTCCGG + Intergenic
991567600 5:68020725-68020747 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
992048837 5:72925530-72925552 TCGCGGGCCAGTGCGAGTTCTGG + Intergenic
992050334 5:72935277-72935299 TCGCGGGCCAGCGTGAGTTCCGG + Intergenic
992296710 5:75333724-75333746 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
992947295 5:81823114-81823136 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
992947419 5:81823761-81823783 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
993031836 5:82714719-82714741 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
993328609 5:86569845-86569867 TTGCGGGCCAGCTGGAGTTCAGG - Intergenic
993529218 5:89003939-89003961 TTGCGGGACAGCTGGAGTTCCGG - Intergenic
993678626 5:90847794-90847816 ACCAGGGCCAGCGCGAGTTCCGG - Intronic
993770253 5:91917316-91917338 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
993822004 5:92631372-92631394 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
994096310 5:95851206-95851228 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
994210804 5:97085550-97085572 TCGTGGGCCAGCGCGAGTTCCGG - Intergenic
994239844 5:97407218-97407240 TTGCGGGCAAGCACGAGTTCCGG + Intergenic
994251548 5:97542200-97542222 TTGTGGGCCAGCAGGAGTTCCGG - Intergenic
994254820 5:97580314-97580336 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
994411360 5:99410602-99410624 TCGCGGGCAGGCGCGGGTTCTGG - Intergenic
994507080 5:100656802-100656824 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
994509871 5:100689188-100689210 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
994570270 5:101506066-101506088 TTGCAGGCCAGTGTGAGTTCCGG + Intergenic
994605633 5:101962767-101962789 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
994620309 5:102154979-102155001 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
994647779 5:102491668-102491690 TTGCGGGCCAGCACGAGTTCTGG - Intronic
994669722 5:102752106-102752128 TTGCAGGCCAGCTAGAGTTCCGG + Intergenic
994701730 5:103142358-103142380 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
994769817 5:103966646-103966668 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
994841362 5:104929042-104929064 TTGCTGGGCAGCACGAGTTCCGG + Intergenic
994935260 5:106246292-106246314 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
995032290 5:107494284-107494306 TTGAGGGCCAGCTGGAGTTCCGG + Intronic
995112399 5:108442360-108442382 TTGCAGGCCAGCATGAGTTCTGG - Intergenic
995206682 5:109488132-109488154 CGCCGGACCAGCGCGAGTTCCGG - Intergenic
995388374 5:111612480-111612502 TTGCAGGCCAGCTAGAATTCCGG - Intergenic
995596480 5:113753439-113753461 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
995656479 5:114432720-114432742 TTGTGGGCCAGCTGGAGTTCCGG + Intronic
995679901 5:114704610-114704632 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
995920367 5:117304700-117304722 TTGAGGGCCAGCTGGAGTTCCGG + Intergenic
995975780 5:118033818-118033840 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
996107017 5:119517143-119517165 TCGCAGGCCAGCTTGAGTTCTGG + Intronic
996234193 5:121107216-121107238 TTGAGGGCCAGCTGGAGTTCCGG + Intergenic
996298587 5:121954273-121954295 TCGCGGGCCAGCGCTAGTTCCGG - Intergenic
996435660 5:123430586-123430608 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
996478723 5:123949509-123949531 TTGCGGGCCAGCGGGAGTTCCGG - Intergenic
996567167 5:124892455-124892477 TCGCGGGCCAGCGCGAGTTCCGG + Intergenic
996585971 5:125088742-125088764 TTGTGGGCCAGCGCGAGTTCCGG + Intergenic
996747128 5:126854852-126854874 TTGCAGGCCAGCGTGAGTTCCGG - Intergenic
996815546 5:127569494-127569516 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
997352189 5:133239026-133239048 TTGTGGGCCAGCGTGAGTTTCGG + Intronic
997760528 5:136444252-136444274 TTGAGGGCCAGTTGGAGTTCCGG + Intergenic
998117509 5:139549384-139549406 TCGAGGGCCAGCGCGAGTTCCGG + Intronic
999348522 5:150845503-150845525 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
999406149 5:151309226-151309248 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1000084717 5:157879329-157879351 TCACGGGCCAGCGCAAGTTCCGG + Intergenic
1000212335 5:159119212-159119234 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1000432381 5:161166427-161166449 TTGCGGGCCAGTGCAAGTTCCGG - Intergenic
1000547582 5:162621882-162621904 TTGCGGGCCAACTAGACTTCTGG + Intergenic
1000609118 5:163355896-163355918 TTGTGGGCCAGTGCGAGCTCTGG + Intergenic
1000889341 5:166784818-166784840 TTGTGGGCCAGCATGAGTTCGGG - Intergenic
1000891848 5:166810517-166810539 TTGCAGGCCAGCTGGAGTTCTGG - Intergenic
1000902515 5:166927268-166927290 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1000903569 5:166936536-166936558 TTGTGGGGCAGCACGAGTTCGGG - Intergenic
1001636417 5:173213484-173213506 TTGCGGGCCAGCTAGAGTTCTGG + Intergenic
1001841515 5:174880708-174880730 TTGTGGGCCAGCTAGTGTTCTGG + Intergenic
1002004665 5:176222346-176222368 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1002221713 5:177688274-177688296 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1002612754 5:180432205-180432227 TCGCGGGACAGCGCGAGTTCTGG + Intergenic
1002616416 5:180459211-180459233 TTGCGGGCCAGCAGAAGTTCTGG + Intergenic
1002789408 6:426522-426544 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1002790759 6:435859-435881 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1002793179 6:450025-450047 TTGCAGGCCAGCTACAGTTCCGG + Intergenic
1002817681 6:694666-694688 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
1002907054 6:1457292-1457314 TTGCGGGCCAGCGCGAGTTCAGG - Intergenic
1003048948 6:2763589-2763611 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1003060695 6:2860183-2860205 TTGCTGGCCAGCTGGAGTTCCGG + Intergenic
1003069639 6:2935848-2935870 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1003070192 6:2939669-2939691 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1003081883 6:3027741-3027763 TTGCGGGGCAGCTGGAGTTCCGG + Intergenic
1003170880 6:3721086-3721108 TTGCTGGCCAGCTGGAGTTCCGG - Intergenic
1003176845 6:3758203-3758225 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1003177254 6:3761428-3761450 TTATGGACCGGCGCGAGTTCCGG + Intergenic
1003178457 6:3771677-3771699 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1003213721 6:4090181-4090203 TTGTGGGCCAGCGCCAGTTCCGG + Intronic
1003284880 6:4725628-4725650 TTGCAGGCCAGTGCGAGTTCCGG - Intronic
1003489249 6:6606747-6606769 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
1003506703 6:6745995-6746017 TTGCGGGCCAGCGCAAGTTCCGG - Intergenic
1003508867 6:6762801-6762823 TTGAGAGCCAGCTAGAGTTCCGG - Intergenic
1003578010 6:7315260-7315282 TTGCCAGCCAGTGCGAGTTCCGG + Intronic
1003578320 6:7317055-7317077 TTGTGGGCCAGCGCGAGTTCCGG - Intronic
1003581416 6:7344256-7344278 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1003591596 6:7441313-7441335 TTGCGGGCCAGAGCGAGTTCTGG + Intergenic
1003593689 6:7456399-7456421 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
1003671509 6:8164376-8164398 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1003717668 6:8666007-8666029 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1003736868 6:8887206-8887228 TTGCGGGCCAGCTGGAGTTCGGG + Intergenic
1003747980 6:9024317-9024339 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1003770188 6:9290757-9290779 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1003836241 6:10074999-10075021 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
1003845701 6:10171762-10171784 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1003862763 6:10337450-10337472 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1003882078 6:10488057-10488079 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1003897043 6:10617338-10617360 TTGCCGGCCAGCGTGAGTTCCGG - Intronic
1003901561 6:10659925-10659947 TTGCCGGCCAGCTAGAGTTCCGG + Intergenic
1003947250 6:11087256-11087278 TTGCGGGCCAGCTGGAGCTCCGG + Intergenic
1003956649 6:11171113-11171135 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1003984000 6:11417315-11417337 TCACGGGCCAGCGCGAGTTCCGG - Intergenic
1004036936 6:11933120-11933142 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1004053183 6:12108711-12108733 TTGCAGGCCAGCTGGAGCTCCGG - Intronic
1004196613 6:13511351-13511373 TTGCGGGTCGGCGCGAGTTCCGG - Intergenic
1004217556 6:13716790-13716812 TCGCGGGCCAGGGCAAGTTCCGG + Intergenic
1004220583 6:13743240-13743262 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1004233734 6:13855038-13855060 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1004248432 6:14002465-14002487 TTGCAGGCCAGCGCAAGTTCTGG + Intergenic
1004250286 6:14018074-14018096 TTGCAGGCCAGCACGAGTTCCGG + Intergenic
1004338243 6:14783888-14783910 TTGCCGGCCGGCGCGAGTTCCGG - Intergenic
1004354045 6:14916028-14916050 TCACAGGCCAGCACGAGTTCTGG + Intergenic
1004452417 6:15759079-15759101 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1004483249 6:16040639-16040661 TTGCGGGCCAGCGCGAGCTCTGG - Intergenic
1004486300 6:16069508-16069530 TTGCGGGCCCGCTGGAGTTCCGG - Intergenic
1004499702 6:16198411-16198433 TTGCAGGCCAGCTAGATTTCCGG - Intergenic
1004501862 6:16216861-16216883 TTGCCGGCCAGCGCGAGTTCCGG + Intergenic
1004502118 6:16218318-16218340 TTGTGGGCCAGCTGCAGTTCCGG - Intergenic
1004503236 6:16227217-16227239 TTGCGGGCCAGCACGAGTTCCGG - Intergenic
1004511618 6:16288293-16288315 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1004587466 6:17016081-17016103 TCGCGGGCCAGCGCAAGTTCCGG - Intergenic
1004606579 6:17200649-17200671 TCGCGGGCCGGCACGGGTTCTGG + Intergenic
1004607399 6:17206759-17206781 TTGGGGGCCAGCGCGAGTTCCGG - Intergenic
1004663284 6:17728799-17728821 TCGGGGGCCAGCGCGAGTTCCGG + Intergenic
1004665556 6:17745628-17745650 TTGCGGACCAGCTGGAGTTCCGG - Intergenic
1004689122 6:17976509-17976531 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
1004694537 6:18021310-18021332 TTGCAAACCAGCTCGAGTTCCGG - Intergenic
1004883677 6:20032385-20032407 TTGCGGGACAGCGCGATTTCCGG + Intergenic
1004908491 6:20259607-20259629 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1004912601 6:20301292-20301314 TTGCAGGCCAGCAGGAGTTCCGG + Intergenic
1004914421 6:20318958-20318980 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1005035598 6:21552605-21552627 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1005042288 6:21610182-21610204 TTGCTGGAGAGCGCGAGTTCCGG - Intergenic
1005332910 6:24766257-24766279 TTGCGAGCCAGCTGGAGTTCCGG - Intergenic
1005561415 6:27045325-27045347 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
1005596239 6:27381379-27381401 TTGGGGGCCAGCTGGAGTTCCGG - Intronic
1005600905 6:27425149-27425171 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1005707475 6:28469674-28469696 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1005725087 6:28640063-28640085 TTGCGGGCCAGGGTGAGTTCCGG - Intergenic
1005749093 6:28866761-28866783 TGCGGGCCCAGCGCGAGTTCCGG - Intergenic
1005749961 6:28872914-28872936 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1005758923 6:28950114-28950136 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1005759776 6:28957884-28957906 TTGCCGGCCAGCTGGAGTTCCGG + Intergenic
1005766284 6:29015134-29015156 TTGCGGGCCAGTGCGAGTTCCGG + Intergenic
1005977035 6:30807763-30807785 TTGGGCGCCAGCGGGAGTTCCGG - Intergenic
1005978270 6:30816619-30816641 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1006005750 6:31000529-31000551 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1006033606 6:31195500-31195522 TTGCCGGCCAGCTGGAGTTCCGG + Intergenic
1006127938 6:31852096-31852118 TTGTGGGCCAGCGCAAGTTCCGG + Intergenic
1006351130 6:33521820-33521842 CTGCGCGCCAGCTCGAGTTCCGG - Intergenic
1006477801 6:34269065-34269087 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1006497923 6:34437327-34437349 TCGCGGGCCAGCGCGAATTCTGG - Intergenic
1006983042 6:38161039-38161061 TTGCGCGCCAGCCCGTGTTAAGG - Intergenic
1007666524 6:43516754-43516776 TTCCGGGCCAGCTCCATTTCGGG + Exonic
1007738707 6:43998137-43998159 TTGCGGGCCAGCGCAAGTTCCGG + Intergenic
1008005622 6:46406087-46406109 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
1008038752 6:46774638-46774660 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1008254043 6:49275481-49275503 TTGTGGGCCAGCACGAGTTCCGG + Intergenic
1008270216 6:49482144-49482166 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1008284375 6:49629870-49629892 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
1008770967 6:54979275-54979297 TTGCGGGCCAGCTGGAATTCCGG + Intergenic
1008844808 6:55950349-55950371 TCACAGGCCAGTGCGAGTTCCGG + Intergenic
1009402710 6:63275251-63275273 TTGAGGGCCAGCGCGAGTTCTGG - Intergenic
1009407127 6:63326775-63326797 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1009471391 6:64031196-64031218 TTGCAGGCCAGCATGAGTTCTGG + Intronic
1009587622 6:65627565-65627587 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1009587626 6:65627582-65627604 TTCCGGGTCAGCTGGAGTTCCGG + Intronic
1009685308 6:66949255-66949277 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1009746657 6:67825441-67825463 TCGCGTGCCAGTGCGAGTTCCGG + Intergenic
1009800699 6:68533473-68533495 TTGGGGGCCAGCCTGAGTTCTGG + Intergenic
1010066268 6:71686199-71686221 TTGCAGGCCAGCGGGAGTTCCGG + Intergenic
1010199344 6:73269194-73269216 TTGCAGGCCAGCTGGAGTTCCGG - Intronic
1010235679 6:73572857-73572879 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1010269318 6:73903198-73903220 TCGTGGGCCAGCGTGAGTTCTGG + Intergenic
1010270343 6:73910027-73910049 TCGAGGGCCAGTGTGAGTTCTGG + Intergenic
1010277974 6:73990951-73990973 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
1010617350 6:78029838-78029860 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1011143661 6:84189407-84189429 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1011178103 6:84587471-84587493 TTGTGGGCCAGTGCGAGTTCCGG + Intergenic
1011246494 6:85326018-85326040 TTGCGGGCTAGCTGGAGTTCCGG + Intergenic
1011410353 6:87060078-87060100 TCGTGGTCCAGCGCCAGTTCTGG - Intergenic
1011620117 6:89234767-89234789 TTGCTGGCCAGCGTGAGTTCTGG - Intergenic
1011879957 6:92012064-92012086 TTGCGGGCCAGCGCGAGTTCTGG - Intergenic
1011931775 6:92723537-92723559 TCGCGGGCCAGCGTGAGTTCCGG + Intergenic
1012189370 6:96261266-96261288 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1012733563 6:102910961-102910983 TTGCTGGCCAGCGCGAGTTCCGG - Intergenic
1012760532 6:103294724-103294746 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1012850969 6:104446375-104446397 TTGCAGGCCAGCGTGAGTTCCGG + Intergenic
1013025752 6:106269727-106269749 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1013080204 6:106805804-106805826 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1013081516 6:106817083-106817105 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1013143598 6:107364566-107364588 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1013410805 6:109881462-109881484 TTGCAGGCCAGCTGGAGTTCTGG - Intergenic
1013694832 6:112689644-112689666 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1013694836 6:112689661-112689683 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1013694840 6:112689678-112689700 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1013694843 6:112689695-112689717 TTCTGGGCCAGCGCGAGTTCCGG - Intergenic
1013694848 6:112689712-112689734 TTCCCTGCCAGCGCGAGTTCTGG - Intergenic
1013955375 6:115834921-115834943 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1013960063 6:115889144-115889166 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1013963472 6:115928360-115928382 TTGCGGGCCACCACGAGTTCCGG - Intergenic
1014055857 6:117014800-117014822 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1014088407 6:117373607-117373629 TCGCAGGCCAGCACGAGTTCTGG - Intronic
1014240710 6:119015363-119015385 TTGCGGGCCAGCTGGAGTTCTGG + Intronic
1014280781 6:119441039-119441061 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1014460282 6:121686734-121686756 TTGCGCGCCAGCGCAAGTTCCGG - Intergenic
1014507733 6:122280620-122280642 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1014577452 6:123091215-123091237 TTGAGGGCCAGCTCCAGCTCAGG - Intergenic
1014718534 6:124892012-124892034 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1014738968 6:125125892-125125914 TTGCGGGCCGGCGCAAGTTCCGG + Intronic
1014788443 6:125644491-125644513 TTGCGGGCCAGCGGGAGTTCCGG + Intergenic
1014921102 6:127214911-127214933 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1015572284 6:134633866-134633888 TTGCAGGCCAGCTGGAGTTCTGG - Intergenic
1015600316 6:134904770-134904792 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1016067402 6:139698236-139698258 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1016092862 6:139999905-139999927 TTGTGGGCCAGCTGGAGTTCTGG - Intergenic
1016104758 6:140148441-140148463 TTGCGCGCCAGCGCGAGTTCCGG - Intergenic
1016217165 6:141618251-141618273 TTGCCGGCCAGCGGGAGTTCTGG + Intergenic
1016482347 6:144495464-144495486 TTGTGGGCCAGCTGGAGTTCCGG - Intronic
1016858948 6:148698365-148698387 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1016859088 6:148698901-148698923 TGCGGGGCCAGCGCCAGTTCCGG - Intergenic
1017298953 6:152834383-152834405 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1017310068 6:152966250-152966272 TTGTGGGCCAGGGCCAGTTCCGG - Intergenic
1017325056 6:153133661-153133683 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1017537339 6:155363091-155363113 TTGCGAGCCAGCTGGAGTTCAGG + Intergenic
1018064268 6:160114822-160114844 TTGCGGGCCAGCTGGAATTCCGG - Intergenic
1018109428 6:160520588-160520610 TCGCGGGCCAGCGCGAGTTCCGG - Intergenic
1018545646 6:164933339-164933361 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1018551358 6:165001905-165001927 TCGCGGGCCAGCACGAGTTCCGG - Intergenic
1019000294 6:168744106-168744128 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1019618381 7:1977437-1977459 TCACAGGCCAGTGCGAGTTCTGG - Intronic
1019944302 7:4314259-4314281 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1019965784 7:4497251-4497273 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1020008256 7:4793567-4793589 TTGCGGGCCAGCGCGAGTTCCGG + Intronic
1020074469 7:5248647-5248669 TTGCGGTTCAGGGCGAGGTCTGG - Intergenic
1020163912 7:5793624-5793646 TTGCGGGCTAGCTAGAGTTCCGG + Intergenic
1020375377 7:7478865-7478887 TTGCAGGCCAGCTAGAATTCCGG - Intronic
1020552303 7:9621767-9621789 TCGCGGGCCAGCGTGAGTTCCGG - Intergenic
1020662224 7:10995848-10995870 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
1020784472 7:12556479-12556501 TTGCGTGCCAGCGCGAGTTCCGG - Intergenic
1021006187 7:15397326-15397348 TCGCGGGCCGGCTCGGGTTCCGG - Intronic
1021021020 7:15599180-15599202 TTGTGGGCAAGCGTGAGGTCTGG + Intergenic
1021065786 7:16170893-16170915 TCGCAGGCCAGTGCAAGTTCCGG - Intronic
1021324092 7:19245523-19245545 TTGCCGGCCAGCTGGAGTTCCGG + Intergenic
1021513843 7:21461566-21461588 TTGCAGGCCAGCTAGAGTTCCGG - Intronic
1021520725 7:21536856-21536878 TTGCGGGCCAGCACAAGTTCCGG - Intergenic
1021567360 7:22028719-22028741 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1021567914 7:22032645-22032667 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1021573843 7:22090362-22090384 TCGCAGGCTAGCGCGAGTTCTGG + Intergenic
1021761310 7:23905035-23905057 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1022174167 7:27857333-27857355 TTGCAGGCCAGCACGAGTTCCGG - Intronic
1022531554 7:31070047-31070069 TTGGGGGCCAGAGCCAGCTCTGG + Intronic
1022750405 7:33219013-33219035 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1024269044 7:47628516-47628538 TTGCTGGCCAGCTGGAGTTCCGG + Intergenic
1024335668 7:48203237-48203259 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1024443824 7:49453734-49453756 TTGCCGGCCAGCCTGAGTTCTGG + Intergenic
1024465876 7:49711293-49711315 TTGCGGGCCAGCATGAGTTCTGG + Intergenic
1024700667 7:51901216-51901238 TTGCGGGCTAGCTGGAGTTCCGG - Intergenic
1024735852 7:52303234-52303256 TTGTGGGCCAGCGCGAGTTCTGG - Intergenic
1024741750 7:52362690-52362712 TTGCCTGCCAGCTCTAGTTCCGG + Intergenic
1024834014 7:53495060-53495082 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1025962101 7:66231661-66231683 TTGCGGGCTAGCTGGAGTTCCGG - Intronic
1026098369 7:67364845-67364867 TCGCGGGCCAGCGCGAGTTCCGG - Intergenic
1026187119 7:68090735-68090757 TTGCGGGCTAGCTGGAGTTCTGG - Intergenic
1026237026 7:68535421-68535443 TTGCGGGCCAGCACAAGTTTCGG - Intergenic
1026335868 7:69393868-69393890 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1026512311 7:71037634-71037656 TTGCGGGCCAGCTGGAGTTCAGG + Intergenic
1026596590 7:71738400-71738422 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1027238041 7:76309758-76309780 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1027561637 7:79739339-79739361 TTGCTGGCCAGCTGGAGTTCCGG + Intergenic
1027564071 7:79768285-79768307 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1027579748 7:79977930-79977952 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1027665863 7:81042748-81042770 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1027667562 7:81057804-81057826 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1027674439 7:81141777-81141799 TTGCCGGCCAGCGCGAGTTCTGG + Intergenic
1027698316 7:81437409-81437431 TTGCGGGCCAGCTGCAGCTCCGG - Intergenic
1027778933 7:82499652-82499674 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
1027956024 7:84880620-84880642 TTGCGGGCCCGCGCAAGTTCCGG + Intergenic
1028070060 7:86440606-86440628 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1028142470 7:87288763-87288785 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1028392638 7:90334460-90334482 TTGCTGGCCAGCTAGAGTTCTGG + Intergenic
1028511252 7:91627714-91627736 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1028558060 7:92143646-92143668 TTGCGGGCCAGCGCGAGTTCCGG - Intronic
1028719450 7:94012188-94012210 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
1028778295 7:94705534-94705556 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1028852553 7:95552787-95552809 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1028912959 7:96228746-96228768 TCGTGGGCCAGCGTGAGTTCTGG + Intronic
1029407061 7:100381767-100381789 TTGCGGGCCAGCTAGAGTTCTGG + Intronic
1029567481 7:101348614-101348636 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1029809651 7:103034524-103034546 TTGCGGGCCAGCGGGAGTTCCGG - Intronic
1029832405 7:103275246-103275268 TTGCGGGCCATCTGGAGTTCCGG - Intergenic
1029903933 7:104071828-104071850 TTGCAGGCCAGCGCAAGTTCCGG + Intergenic
1029988135 7:104940196-104940218 TTGCAGGCCAGCACGAGTTCCGG + Intergenic
1030215750 7:107042639-107042661 TTGTGGGCCAGCGCGAGTTCCGG - Intergenic
1030292664 7:107888026-107888048 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1030367045 7:108657538-108657560 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1030600013 7:111582264-111582286 TTGCGGGCCAGCTGGAGTTTCGG - Intergenic
1030733450 7:113017382-113017404 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1030780382 7:113593359-113593381 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1030819345 7:114077163-114077185 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1030980710 7:116182243-116182265 TTGCGGGCCAGCGCTAGTTCCGG - Intergenic
1031056562 7:116998319-116998341 TTGCGGGCCAGTGTGAGTTCCGG - Intronic
1031109944 7:117596184-117596206 TTGTGGGCCAGCGCGAGTTCTGG + Intronic
1031213373 7:118858969-118858991 TCGCGAGCCAGCGCCAGTTCCGG - Intergenic
1031292287 7:119951832-119951854 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1031378766 7:121060009-121060031 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1031409180 7:121421769-121421791 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1031513339 7:122674150-122674172 TTGCAGGACAGCGTGAGTTCCGG - Intronic
1031605549 7:123763492-123763514 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1031902835 7:127429205-127429227 TTGCAGGCCAGCTCAAGTTCCGG + Intronic
1032248044 7:130230061-130230083 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
1032339620 7:131058802-131058824 CCGTGGGCCAGCACGAGTTCCGG + Intergenic
1032437086 7:131909366-131909388 TCGCGGGCCAGCTTGAGTTCCGG + Intergenic
1032561637 7:132898928-132898950 TTGCAGGCCAGCTGGAGTTCCGG - Intronic
1033065055 7:138146203-138146225 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1033312457 7:140271626-140271648 TTGCGGGCCAGCGCCAGTTCTGG - Intergenic
1033394115 7:140957265-140957287 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1033664136 7:143424718-143424740 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1033839952 7:145360956-145360978 TTGCGGGCCACTTAGAGTTCCGG - Intergenic
1033866669 7:145697690-145697712 TTGCCGGCCAGCGCGAGTTCCGG - Intergenic
1034091011 7:148363847-148363869 GTGCGGGCCAGCTGGAGTTCCGG + Intronic
1034097882 7:148426448-148426470 TTGCAGGCCAGCTGGAGTTCTGG + Intergenic
1034100385 7:148445546-148445568 TGGTGGGCCAGCGTGAGTTCCGG - Intergenic
1034154986 7:148949120-148949142 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1034167785 7:149039018-149039040 TTGCGGGCCAGCTGAAGTTCCGG - Intergenic
1034632167 7:152539181-152539203 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1034656073 7:152730597-152730619 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1034900820 7:154906962-154906984 TCATGGGCCAGCGCGAGTTCTGG + Intergenic
1034967138 7:155398470-155398492 TTGCGGGCCAGCGTGACTTCCGG - Intergenic
1035151216 7:156874325-156874347 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1035325389 7:158062610-158062632 TCACGGGCCAGCACGAGTTCTGG + Intronic
1035356611 7:158279655-158279677 TTGTGGGCCGGCGCAGGTTCCGG - Intronic
1035683602 8:1507471-1507493 TCATGGGCCAGCGCGAGTTCTGG - Intronic
1035999213 8:4582866-4582888 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1036123849 8:6045339-6045361 TTGCGGGCCCGTGCGAGTTCCGG - Intergenic
1036135033 8:6152746-6152768 TGGCAGGCCAGCACAAGTTCCGG + Intergenic
1036378239 8:8218932-8218954 TTGCGGGCCAGCGTGAGTTCCGG + Intergenic
1036441066 8:8781713-8781735 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1036554680 8:9848077-9848099 TTGCGGGCCAGTGCGAGTTCCGG - Intergenic
1036801340 8:11794844-11794866 TTGCGGGCCAGCGCAAGTTCCGG + Intergenic
1036851335 8:12203685-12203707 TTGTGGGCCAGTGCGAGTTCCGG - Intergenic
1036872699 8:12445959-12445981 TTGTGGGCCAGTGCGAGTTCCGG - Intergenic
1036914948 8:12796334-12796356 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1036928681 8:12931626-12931648 TCGAGGGCCAGCGCGAGTTCCGG - Intergenic
1036952546 8:13154519-13154541 TCGTGGGCCAGCACGAGTTCCGG - Intronic
1037241520 8:16783945-16783967 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1037558928 8:20054830-20054852 TTGTGGGCCAGTGCGAGTTCTGG + Intergenic
1037810941 8:22086593-22086615 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1037957587 8:23071107-23071129 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1037971373 8:23174122-23174144 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1037983498 8:23272157-23272179 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1038726685 8:30088189-30088211 TCGCGGGCCGGCGCAGGTTCCGG + Intergenic
1038847628 8:31244427-31244449 TTGCTGGCCAGCGTGAGTTCCGG - Intergenic
1038870668 8:31489895-31489917 TTACGGGCCAGCTGGAGTTCTGG + Intergenic
1039061274 8:33573942-33573964 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1039068706 8:33631717-33631739 TTGTGGGCCAGCTAGAGTTCTGG + Intergenic
1039284836 8:36028865-36028887 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1039587588 8:38719904-38719926 TTCCGGGCCAGCGCGAGTTCCGG + Intergenic
1039637267 8:39180153-39180175 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1040000844 8:42575254-42575276 TCACGGGCCAGCATGAGTTCCGG + Intergenic
1040014422 8:42689532-42689554 TTGTGGGCCAGCGCGAGTTCCGG + Intergenic
1040323934 8:46331772-46331794 TTGTCGGCCAGCGCGAGTTTTGG + Intergenic
1040583445 8:48716307-48716329 TTATGGGCCAGCACGAGTTCTGG - Intronic
1040723094 8:50349957-50349979 TTATGGGCCAGCTGGAGTTCTGG + Intronic
1040794148 8:51271278-51271300 TTGTGGGCCAGAACAAGTTCCGG + Intergenic
1040804316 8:51377556-51377578 TTGCGGGCCAGCGCGAGTTCCGG + Intronic
1040806869 8:51405128-51405150 GGGCGGGCCAGCGCCAGTTCTGG - Intronic
1040952733 8:52953178-52953200 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1040952860 8:52953852-52953874 TTGTGGGCCAGCACGAGTTCCGG + Intergenic
1040953976 8:52961432-52961454 TTTTTGGCCAGTGCGAGTTCTGG + Intergenic
1041034689 8:53776220-53776242 TTGCGGGCCAGCTGGAGTTCTGG - Intronic
1041604375 8:59762276-59762298 TTGCCGGCCAGCACGAATTCCGG - Intergenic
1041636705 8:60153277-60153299 TTGCAGGCCAGTGCGAGTTCCGG - Intergenic
1041914496 8:63126148-63126170 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1041918900 8:63162028-63162050 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
1042336001 8:67630763-67630785 TAGTGGGCCAGTGTGAGTTCCGG + Intronic
1042512597 8:69626793-69626815 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1043102251 8:76060728-76060750 TTGCGGGCCAGTGCGAGTTCCGG - Intergenic
1043129971 8:76447935-76447957 TTGCGGGTCAGCCGGAGTTCTGG - Intergenic
1043352521 8:79377526-79377548 TTGCAGGCCAGCTGGAGTTCCGG - Intergenic
1043435290 8:80231847-80231869 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1043621062 8:82192571-82192593 TCGCAGGCCAGCGCAAGTTCTGG - Intergenic
1043640139 8:82441461-82441483 TTGCGGGCCAGCTCCAGTTCCGG + Intergenic
1043670607 8:82880728-82880750 TTGCAGGCCACCGCAAGTCCCGG + Intergenic
1043701097 8:83290391-83290413 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1043709848 8:83402977-83402999 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1043731969 8:83694277-83694299 TTGCAGGCCAGCACGAGTTCCGG - Intergenic
1043857131 8:85276101-85276123 TTGCGGGCCAGCACGAGTTCCGG + Intronic
1044075791 8:87820873-87820895 TTGCGGGCCAGCTGCAGTTCCGG + Intergenic
1044088457 8:87971186-87971208 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
1044404863 8:91816402-91816424 TTGCCGGCCAGCGCCAGTTCTGG + Intergenic
1044459680 8:92429551-92429573 ATGTGGGCCAGCACGAGTTCCGG - Intergenic
1044633508 8:94300655-94300677 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1044853551 8:96452371-96452393 TTGCTGGCCAGCAAGAGTTCCGG + Intergenic
1044880693 8:96719407-96719429 TTGCGGAACAGCTGGAGTTCCGG - Intronic
1044963888 8:97556953-97556975 TAGCGGGCCAGCGCGAGTTCCGG + Intergenic
1045096188 8:98800626-98800648 TCATGGGCCAGCACGAGTTCCGG + Intronic
1045232356 8:100317102-100317124 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1045306051 8:100957430-100957452 TTGTGGGCCACCGCAAGTTCCGG - Intergenic
1045407418 8:101880326-101880348 TCGTGGGCCAGCATGAGTTCTGG - Intronic
1045678443 8:104633206-104633228 TCGCAGACCAGTGCGAGTTCAGG - Intronic
1045743367 8:105387612-105387634 TTGCGGGTCAGTGCCAGTTCCGG - Intronic
1045933710 8:107655644-107655666 TTGTGGGCCAGCACGAGTTCTGG + Intergenic
1046149380 8:110202892-110202914 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1046208921 8:111041159-111041181 TTGCGGGCTAGCTGGAGTTCCGG - Intergenic
1046251857 8:111642890-111642912 TTGTGGGCCAGTGCAAGTTCCGG + Intergenic
1046265423 8:111823604-111823626 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1046285070 8:112083256-112083278 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1046288873 8:112132731-112132753 TTGCAGGCCAGCTGGAGTTGCGG + Intergenic
1046445303 8:114311390-114311412 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1046450682 8:114386195-114386217 TTGCGGGCCAGCTGAAGTTCCGG + Intergenic
1046497744 8:115036747-115036769 TCACGGGGCAGCACGAGTTCTGG + Intergenic
1046621189 8:116531126-116531148 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1046661232 8:116950057-116950079 TCGCGGGCCAGCGCGAGTTCCGG - Intergenic
1047100205 8:121667734-121667756 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1047124706 8:121948075-121948097 TTGCGGGCCAGCTAGAGTTCCGG + Intergenic
1047631738 8:126714958-126714980 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1048112830 8:131487084-131487106 TCACGGGCCAGCGCGAGTTCCGG + Intergenic
1048186913 8:132249978-132250000 TCGTGGGCCAGCGCAAGTTCCGG - Intronic
1048576050 8:135690708-135690730 CTGCGGGCCAGCGCGAGTTCTGG - Intergenic
1048655440 8:136530731-136530753 TTCCGGGCCAGCGCGAGTTCCGG - Intergenic
1048676992 8:136794111-136794133 TTGCGGGTCAGCTGGAGTTCGGG - Intergenic
1048757534 8:137755442-137755464 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1048789139 8:138084174-138084196 TTACGAGCCAGCTGGAGTTCCGG + Intergenic
1049087672 8:140490836-140490858 TTACGAGCCAGCTGGAGTTCCGG - Intergenic
1049157678 8:141076726-141076748 TTGCGGGCCAGTGTGAGTTCCGG + Intergenic
1049500280 8:142959516-142959538 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1049857910 8:144875209-144875231 TTGTGGGCCAGCGTGAGTTCCGG + Intergenic
1050249927 9:3733851-3733873 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1050294880 9:4195336-4195358 TCGCAGGCCAGCGCGAGTTCTGG + Intronic
1050975277 9:11929176-11929198 TTGCGGGCCAGTGTGAGTTCTGG - Intergenic
1051305123 9:15700363-15700385 TTGCAGGCCAGCTGGAGTTCCGG - Intronic
1051314222 9:15810725-15810747 TCACAGGGCAGCGCGAGTTCCGG - Intronic
1051383271 9:16480547-16480569 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1051419734 9:16877374-16877396 TTGTGGGCCAGCACGAGTTCTGG - Intergenic
1051425121 9:16924731-16924753 TCGCGGGCCAGCGTGAGCTCTGG - Intergenic
1051439828 9:17072644-17072666 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1051449433 9:17178706-17178728 TTGTGGGCCAGCGTGAATTCCGG - Intronic
1051459460 9:17295151-17295173 CTGCGGGCCAGCTAGAGTTCCGG - Intronic
1051892665 9:21959290-21959312 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1051929084 9:22363794-22363816 TTGCGGACCAGGGCAAGTTCCGG - Intergenic
1052014818 9:23452074-23452096 TTGCGGGCCAGCGTGAGTTCTGG + Intergenic
1052122762 9:24738566-24738588 TCGCAGGCCAGCGCAAGTTCCGG + Intergenic
1052313406 9:27092693-27092715 TTGCGGGCCAGCACGAGTTCCGG + Intergenic
1052576544 9:30299306-30299328 TTGTGGGCCAGCGCCCGGTCCGG + Intergenic
1052835348 9:33246150-33246172 ATGCAGGCCAGGGAGAGTTCAGG + Intronic
1052985381 9:34483086-34483108 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1053393375 9:37751917-37751939 TTGCGGGCCAGCTAGAGTTCCGG + Intronic
1053436068 9:38075416-38075438 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1053475216 9:38377617-38377639 TTGCGGGCCAGCGGGAGTTCCGG + Intergenic
1053547949 9:39042679-39042701 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1053812069 9:41862720-41862742 TGGCGGGCCAGCTGGAGTTCTGG - Intergenic
1054618526 9:67324719-67324741 TGGCGGGCCAGCTGGAGTTCTGG + Intergenic
1054722415 9:68617062-68617084 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1055049328 9:71963578-71963600 TTGCGGGCCAGCTGGAGTTCCGG + Intronic
1055102599 9:72480523-72480545 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1055248629 9:74276252-74276274 TTGCAGGCCAGCGCGAGTTCCGG - Intergenic
1055461484 9:76524011-76524033 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1055557611 9:77490704-77490726 TTGCAGGCCAGCTGGGGTTCCGG - Intronic
1055814198 9:80185618-80185640 TTGCGGGCCAGCTAGAGTTCCGG - Intergenic
1055985537 9:82054654-82054676 TTGCAGGCCAGCGTGAGTTCCGG - Intergenic
1056080998 9:83093628-83093650 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1056305730 9:85289086-85289108 TTGCCGGCCAGCTAGAGTTCCGG + Intergenic
1056735910 9:89209441-89209463 TTGCGGGCCAGCGCGAGTTCTGG + Intergenic
1056771429 9:89480740-89480762 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1057036950 9:91817960-91817982 TTGCGGACCAGAGCGTGTTGAGG - Intronic
1057118139 9:92545310-92545332 TTGCAGGCCAGCTAGAGTTCTGG + Intronic
1057300677 9:93879980-93880002 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1057383954 9:94591465-94591487 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1057628672 9:96701239-96701261 TTGCGGGCCAGCTGCAGTTCCGG - Intergenic
1057689536 9:97271398-97271420 TCGCAGGCCAGTGCGGGTTCCGG - Intergenic
1057726887 9:97574257-97574279 TTGCGGGCCAGCGCGTGTTCCGG + Intronic
1058235716 9:102487261-102487283 TTGCCGGCCAGCGTGAGTTCCGG - Intergenic
1058379596 9:104363222-104363244 TCGTGGGCCAACGTGAGTTCTGG - Intergenic
1058727491 9:107817832-107817854 TTGCAGGCCAGCGCGAGTTCCGG + Intergenic
1058786462 9:108393544-108393566 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1058799340 9:108530184-108530206 TTGCGGGTCACCTGGAGTTCTGG + Intergenic
1059791183 9:117643049-117643071 TTGCGGGCCAGCGTGAATTCCGG - Intergenic
1059810587 9:117852065-117852087 TTGCGGGACAGCTGGAGTTCCGG + Intergenic
1059891475 9:118809537-118809559 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1059991594 9:119870604-119870626 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1060305405 9:122406476-122406498 TTGCGAGCAGGCGCCAGTTCCGG - Intergenic
1060594263 9:124839043-124839065 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1062146244 9:134991353-134991375 TTGCGGGCCAGCTGGACTTCCGG - Intergenic
1203460457 Un_GL000220v1:31307-31329 TTCCGGGCCAACGCGAGTTCCGG - Intergenic
1203660983 Un_KI270753v1:42647-42669 TCGCGGGCCAGTGCTGGTTCCGG + Intergenic
1186152631 X:6690829-6690851 TTGCGGGTCAGCTGGAGTTCCGG - Intergenic
1186282110 X:8003593-8003615 TTGCGGGCCAGCTAGAGTTCTGG - Intergenic
1186293158 X:8121627-8121649 TTGCAGGCCAGCGCGAGTTCCGG + Intergenic
1186323286 X:8452813-8452835 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1187005877 X:15232053-15232075 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1187139013 X:16575492-16575514 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1187304575 X:18083841-18083863 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1187557609 X:20367172-20367194 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1187903983 X:24049730-24049752 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1188111980 X:26204841-26204863 TTGCGGGCTAGCGCGAGTTCCGG + Intergenic
1188189496 X:27157043-27157065 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1189467148 X:41286030-41286052 TTGCAGGCCAGCGTGAGCTCTGG - Intergenic
1190045905 X:47111326-47111348 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1190414001 X:50163652-50163674 TTGCTGGCCAGCTGGAGTTCCGG - Intergenic
1191053938 X:56222874-56222896 TTGCGGGCCAGCTAGAATTCCGG - Intergenic
1191618669 X:63192892-63192914 TTGTGGGCCACCTGGAGTTCCGG - Intergenic
1192022439 X:67408699-67408721 TCGTGGGCCAGCGTGAGTTCTGG + Intergenic
1192251370 X:69416807-69416829 ACCGGGGCCAGCGCGAGTTCCGG + Intergenic
1192869692 X:75173920-75173942 TTGTGGGCCAGCTGGAGTTCCGG - Intergenic
1192870598 X:75179840-75179862 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1193040226 X:76996964-76996986 TTGTGGGCCAGCTGGAATTCTGG - Intergenic
1193538193 X:82738526-82738548 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1193804080 X:85972680-85972702 TTGCGGGCCAGCTGGAGTTCCGG - Intronic
1194025616 X:88746648-88746670 TTACAGGCCAGCACGAGTTCCGG - Intergenic
1194071630 X:89331352-89331374 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1194118064 X:89926857-89926879 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1194121236 X:89965968-89965990 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1194166311 X:90521373-90521395 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1194173512 X:90618079-90618101 TCGCGGGTCAGCACGAGTTCCGG - Intergenic
1194340480 X:92699802-92699824 TTGCGGGCCAGCGTGAGTTCTGG - Intergenic
1194384350 X:93235769-93235791 TTGCGGGCCAGTTAGAGTTCTGG + Intergenic
1194650858 X:96512574-96512596 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1194890514 X:99372358-99372380 TTGCGGGCCAGCGCCAGTTCCGG - Intergenic
1195256286 X:103094152-103094174 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1195259388 X:103117381-103117403 TTGCGGGCCGGCTGGAGTTCTGG - Intergenic
1195460287 X:105116030-105116052 TTGCAGGCCAGCGCAAGTTCTGG - Intronic
1196197953 X:112855177-112855199 TTGCCGGCCAGCATGAGTTCCGG - Intergenic
1196319568 X:114270882-114270904 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1196616114 X:117769106-117769128 TTGCGGGCCAGCGCGAGTTCCGG + Intergenic
1196662549 X:118283026-118283048 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1196705951 X:118717262-118717284 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1196714578 X:118798994-118799016 TTGTGGGCCAGCTGGAGTTCCGG + Intergenic
1196728968 X:118922307-118922329 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1196775170 X:119331912-119331934 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1196775471 X:119333633-119333655 TTGCAGGCCAGCTGGAGTTCCGG + Intergenic
1196794016 X:119488186-119488208 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1196827312 X:119751151-119751173 TTGCGGGCCAGCTGGAGTTCTGG - Intergenic
1196845023 X:119890629-119890651 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1196860895 X:120026108-120026130 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1197000323 X:121431851-121431873 TTGCAGGCCAGCTGGAGTTTCGG - Intergenic
1197331209 X:125155782-125155804 TTGCGGGCCAGAACGAGTTCCGG - Intergenic
1197340016 X:125255685-125255707 TTGGGGGCCAGCTGGAGTTCCGG + Intergenic
1197344859 X:125319384-125319406 TTGTGGGCCAGCTGGGGTTCCGG - Intergenic
1197376836 X:125690902-125690924 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1197533805 X:127663292-127663314 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1197607891 X:128606643-128606665 TTGCGGGCCAGCGAGAGTTCCGG + Intergenic
1197978725 X:132194124-132194146 TCACGGGCCAGCGCGAGATCCGG + Intergenic
1198060884 X:133044415-133044437 TTGCGGGCCAGCTAGAGTTCCGG + Intronic
1198664346 X:139004348-139004370 TTGCCGGCCAGCTGGAGTTCCGG - Intronic
1198694413 X:139320841-139320863 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1198972626 X:142298568-142298590 TGGCGGGCCAGCTGGAGTTCCGG - Intergenic
1199009976 X:142746046-142746068 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1199028832 X:142972459-142972481 TTGGGGGCCAGCTGGAGTTACGG - Intergenic
1199050262 X:143229013-143229035 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1199134197 X:144231532-144231554 TTGCGGGCCAGCGCGAGTTCCGG - Intergenic
1199285126 X:146046478-146046500 TTGCGAGCCAGTGCGTGTTCCGG - Intergenic
1199443710 X:147897296-147897318 TCGTGGGCCAGTGCGGGTTCCGG - Intergenic
1199628081 X:149758607-149758629 TTGCGGGCCAGCACGACTTCCGG + Intergenic
1199831319 X:151551510-151551532 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1199831811 X:151555473-151555495 TTGCAGGCCAGCACGAGTTCCGG - Intergenic
1199833057 X:151563102-151563124 TTGCGGGCCAGCGCAAGTTCCGG - Intergenic
1200423597 Y:2998698-2998720 TTGCGTGCCAGCTGGAGTTCCGG - Intergenic
1200470943 Y:3584426-3584448 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1200512580 Y:4099154-4099176 TTGCGTGCCAGCTGGAGTTCCGG + Intergenic
1200648836 Y:5816538-5816560 TTGCGGGCCAGCGTGAGTTCTGG - Intergenic
1200725873 Y:6667081-6667103 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1200824332 Y:7622539-7622561 TTGCGGGCCAGCTGGGGTTCCGG - Intergenic
1200829058 Y:7673170-7673192 TTGTGGGCCAGAGCGAGTTCCGG + Intergenic
1200873659 Y:8128839-8128861 TTGCGGGCCAGCTAGAGCTCTGG - Intergenic
1200888646 Y:8298655-8298677 TTGCGGGCCAGCTGGAGTTCTGG + Intergenic
1200955295 Y:8938375-8938397 TCGAGGGCCAGCATGAGTTCTGG + Intergenic
1201260972 Y:12158694-12158716 TTGTGGGCCAATGCGAGTTCCGG - Intergenic
1201285517 Y:12375330-12375352 TTGCGGGCCAGCTAGAGTTATGG - Intergenic
1201423078 Y:13820527-13820549 TTGCGGACCAGCTGGAGTTCCGG - Intergenic
1201424216 Y:13831388-13831410 TTGGGGGCCAGCGTGAGTTCTGG + Intergenic
1201429163 Y:13887899-13887921 TTGTGGGCCAGCGCAAGTTCAGG + Intergenic
1201479900 Y:14428128-14428150 TTGTGAGCCAGCTGGAGTTCCGG + Intergenic
1201495723 Y:14590106-14590128 TTGTGGGCCAGCTGGAGTTCCGG - Intronic
1201496967 Y:14598519-14598541 TTGCAGGCCAGCTGGAGTTCTGG - Intronic
1201499614 Y:14627615-14627637 TTGCGGGCCAGCGCGAGTTCTGG - Intronic
1201572999 Y:15433882-15433904 TTGCAGGCCAGCTGGAGTTCTGG + Intergenic
1201715770 Y:17043145-17043167 TTGCGGGCCAGCTGGAGTTCCGG + Intergenic
1201885754 Y:18880213-18880235 TTGCGGGCCAGCAGGAGTTCTGG + Intergenic
1201982654 Y:19924038-19924060 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1202100612 Y:21303888-21303910 TCACGGGCCAGCACGAGTTCTGG - Intergenic
1202137131 Y:21676985-21677007 TTGCGGGCCAGCTGGAGTTCCGG - Intergenic
1202202454 Y:22367482-22367504 TTGCAGGCCAGCAGGAGTTCTGG - Intronic
1202235723 Y:22708548-22708570 TTGCGGGCCAGCTGGGGTTCCGG + Intergenic
1202271522 Y:23078662-23078684 TTGTGGGCCAGCTAGAGTTCTGG - Intergenic
1202272691 Y:23086085-23086107 TTGCGGGCCCGCTTGAGTTCCGG - Intergenic
1202293335 Y:23334597-23334619 TTGCGGGCCCGCTTGAGTTCCGG + Intergenic
1202294504 Y:23342020-23342042 TTGTGGGCCAGCTAGAGTTCTGG + Intergenic
1202307440 Y:23487620-23487642 TTGTGAGCCAGCTGGAGTTCCGG - Intergenic
1202424517 Y:24712406-24712428 TTGTGGGCCAGCTAGAGTTCTGG - Intergenic
1202425688 Y:24719829-24719851 TTGCGGGCCCGCTTGAGTTCCGG - Intergenic
1202445101 Y:24950256-24950278 TTGCGGGCCCGCTTGAGTTCCGG + Intergenic
1202446272 Y:24957679-24957701 TTGTGGGCCAGCTAGAGTTCTGG + Intergenic
1202563365 Y:26182966-26182988 TTGCGGGCCAGCTGGGGTTCCGG + Intergenic