ID: 1002790762

View in Genome Browser
Species Human (GRCh38)
Location 6:435877-435899
Sequence CGCAAGCGCCGCGCACAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002790751_1002790762 12 Left 1002790751 6:435842-435864 CCCGAGCCCACGCCCACCCGGAA No data
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790750_1002790762 13 Left 1002790750 6:435841-435863 CCCCGAGCCCACGCCCACCCGGA No data
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790748_1002790762 14 Left 1002790748 6:435840-435862 CCCCCGAGCCCACGCCCACCCGG 0: 86
1: 601
2: 586
3: 370
4: 512
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790752_1002790762 11 Left 1002790752 6:435843-435865 CCGAGCCCACGCCCACCCGGAAC 0: 615
1: 639
2: 402
3: 209
4: 255
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790754_1002790762 5 Left 1002790754 6:435849-435871 CCACGCCCACCCGGAACTCGCGC 0: 121
1: 263
2: 778
3: 665
4: 417
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790753_1002790762 6 Left 1002790753 6:435848-435870 CCCACGCCCACCCGGAACTCGCG 0: 114
1: 223
2: 761
3: 668
4: 406
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790759_1002790762 -5 Left 1002790759 6:435859-435881 CCGGAACTCGCGCTGGCCCGCAA 0: 106
1: 205
2: 734
3: 503
4: 228
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790746_1002790762 27 Left 1002790746 6:435827-435849 CCGAGTGCGGGGCCCCCCGAGCC No data
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790758_1002790762 -4 Left 1002790758 6:435858-435880 CCCGGAACTCGCGCTGGCCCGCA 0: 102
1: 233
2: 780
3: 602
4: 375
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790756_1002790762 0 Left 1002790756 6:435854-435876 CCCACCCGGAACTCGCGCTGGCC 0: 142
1: 328
2: 906
3: 662
4: 273
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790747_1002790762 15 Left 1002790747 6:435839-435861 CCCCCCGAGCCCACGCCCACCCG No data
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data
1002790757_1002790762 -1 Left 1002790757 6:435855-435877 CCACCCGGAACTCGCGCTGGCCC 0: 125
1: 272
2: 818
3: 693
4: 407
Right 1002790762 6:435877-435899 CGCAAGCGCCGCGCACAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002790762 Original CRISPR CGCAAGCGCCGCGCACAGTC CGG Intergenic
No off target data available for this crispr