ID: 1002800112

View in Genome Browser
Species Human (GRCh38)
Location 6:514646-514668
Sequence CAGCTGCTCCAGGGGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 2, 2: 8, 3: 72, 4: 554}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002800112 Original CRISPR CAGCTGCTCCAGGGGCTCCA GGG Intronic
900144177 1:1150787-1150809 CGGCTGCCCCAGGGTCCCCAGGG - Intergenic
900145774 1:1158138-1158160 CCGCAGCTCCAGAGGCTCCTGGG + Intergenic
900364779 1:2306659-2306681 CACCTTCTCCAGGTGCTCCCGGG - Exonic
900403622 1:2482984-2483006 CAGCCCACCCAGGGGCTCCAAGG - Intronic
900417113 1:2540351-2540373 CAGCTGCTCCTAGGGCACCTGGG + Intergenic
900610918 1:3544323-3544345 CAGGGGCTCCTGGGGCTGCAGGG + Intronic
901075935 1:6554650-6554672 GATCTGGTCGAGGGGCTCCACGG + Intergenic
901103113 1:6734596-6734618 CATCTGCATCAGGGACTCCAAGG - Intergenic
901510890 1:9717550-9717572 CGGCTGCTCCAGGGACCACAGGG - Exonic
901836316 1:11926203-11926225 CAGCGGCTCAAGGGGCTGCCGGG - Exonic
902044190 1:13513132-13513154 CAGCGACTCCAGGGTCTCGAAGG + Exonic
902124921 1:14201439-14201461 CAGCTGCTCCGGGGCAGCCAGGG - Intergenic
902282086 1:15382126-15382148 CTGGTGCTCCATGCGCTCCAGGG - Exonic
902577362 1:17386734-17386756 CAGCATCCCCAGGGCCTCCAAGG + Intronic
903369696 1:22827240-22827262 CACATGTTCCAGGGGCTCCGAGG - Intronic
903890867 1:26569564-26569586 TACCTACTCCACGGGCTCCACGG + Intronic
903907701 1:26697484-26697506 CCGCTGCTCCCGGGGCTCATGGG - Exonic
903996463 1:27307990-27308012 CAGCTGGTCCTTGGGCCCCAGGG - Exonic
904321132 1:29698413-29698435 CAGCTTCTCCCTGGTCTCCAAGG - Intergenic
904401120 1:30257482-30257504 CTGTTGCTCCTGGAGCTCCAGGG - Intergenic
904597114 1:31653919-31653941 CAGGTGCTCCAGGGTCACCTGGG - Exonic
905168806 1:36098411-36098433 CAGTTGGTCCAGGGGGTCCATGG + Exonic
905849500 1:41263016-41263038 GAGCTGCCCCATGGTCTCCAAGG - Intergenic
906108181 1:43307067-43307089 CTGGAGATCCAGGGGCTCCAGGG - Intronic
907188570 1:52630816-52630838 CAGAGGCTCCTTGGGCTCCATGG - Intergenic
907338395 1:53715786-53715808 CAGGTCCTCCACGGCCTCCATGG - Intronic
907462709 1:54614795-54614817 CAGCTGCCGCAGGAGGTCCAGGG + Exonic
907559679 1:55377060-55377082 CAGCAGGTGCAGAGGCTCCAAGG + Intergenic
908659063 1:66418672-66418694 GCGCTGCTGCAGGGGGTCCAGGG + Intergenic
909107117 1:71425451-71425473 CAAATGCTCCAGAGACTCCAAGG + Intronic
910503267 1:87919063-87919085 CAGCTGCTAGAAGGGCTGCAAGG - Intergenic
910758893 1:90716968-90716990 ATGCGGCTCCGGGGGCTCCATGG + Exonic
910935648 1:92483515-92483537 CAGCGGCTCCAGGGACTCTTGGG - Exonic
911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG + Intronic
913124179 1:115770031-115770053 CAGCTTCTGCAGGGGCTAGAAGG + Intergenic
913260201 1:116990855-116990877 CAGCTGTTCCAGGGGCCCGCAGG - Intergenic
915902372 1:159855968-159855990 CTGCTGCTGCGGGGGCTCCGGGG - Exonic
915996133 1:160565814-160565836 CAGCTCCTCAGGGAGCTCCAAGG - Intronic
916519609 1:165552007-165552029 CAGCAGCTCCAAGGCTTCCAAGG + Intronic
916742634 1:167659850-167659872 CCTCTGCTCCAGGGCCTCCCAGG + Intronic
917669303 1:177257284-177257306 CAGCTGGTGCAGGGTCTCCAGGG - Exonic
918048475 1:180955043-180955065 GAGCTGCTCGAGGGCCTCCAAGG - Intergenic
919880211 1:201896028-201896050 CAGCTGCTCCAGGGGTGCCCTGG - Intergenic
919880214 1:201896037-201896059 CAGATTCTCCAGCTGCTCCAGGG - Intergenic
920434194 1:205937720-205937742 CACCTGCTCCAGAGTCTGCATGG + Intronic
923248491 1:232157201-232157223 CAGCTGCTCCAGGGCCCACCTGG - Intergenic
1062857870 10:788359-788381 CAGCAGCTGCAGGGGGTCTAGGG + Intergenic
1063224725 10:4005068-4005090 CAGCTGCGGGAGGGGCACCACGG - Intergenic
1067064096 10:43093967-43093989 CAGCAGGGCCACGGGCTCCAGGG + Intronic
1067069312 10:43120399-43120421 CTTCTCCTCCAGGGCCTCCAGGG + Intronic
1068404740 10:56574383-56574405 GTGCTGCTGCAGGGGGTCCAGGG + Intergenic
1069356953 10:67597777-67597799 CATGTGCTCCAGTGGCACCAGGG + Intronic
1069371327 10:67750704-67750726 CAGCTCCTCCATGGCCTCCCAGG - Intergenic
1069884497 10:71615322-71615344 CGGCTGCTCCATGGACTCCAGGG + Intronic
1070167921 10:73911983-73912005 CCCATGCTCCAGGGACTCCAGGG - Exonic
1070723092 10:78770215-78770237 CAGTCCCTCCAGAGGCTCCAGGG + Intergenic
1071298168 10:84237545-84237567 CAGCTGCTCCAGGCGGCCCAGGG + Exonic
1071356368 10:84800308-84800330 CAACTGGCACAGGGGCTCCAAGG - Intergenic
1071919074 10:90329171-90329193 CACCTCCTCCACAGGCTCCATGG - Intergenic
1072370899 10:94765647-94765669 GAGCTGCTGCAGGGGATCCAGGG + Intronic
1073116257 10:101093536-101093558 GAGAAGCCCCAGGGGCTCCATGG - Intronic
1073510380 10:104039102-104039124 CAGGTGATCCAGGTGTTCCAGGG - Exonic
1074721693 10:116270910-116270932 CTTCTGCTTCAGGGCCTCCATGG + Exonic
1075780052 10:125011673-125011695 CAGCTTCCCCAGGGGCTCTGAGG - Intronic
1075965721 10:126610016-126610038 CAGCTCCTCCAGGGGCCCTCAGG + Intronic
1076132827 10:128025757-128025779 GACCTGCTCCAGGGGACCCAGGG + Intronic
1076136630 10:128049593-128049615 CTCCTCCTCCAGGTGCTCCACGG - Exonic
1076496675 10:130901918-130901940 CAGCTCCTCCAGAGGCTCCCCGG - Intergenic
1076691153 10:132224473-132224495 CAGCTGCACCAGGGACTCCACGG + Exonic
1076706092 10:132302432-132302454 CAGCTGCCCCAAGGGCCCCCAGG + Intronic
1076722895 10:132400460-132400482 CACCTGCCCCAGGATCTCCAGGG - Intronic
1076991778 11:279479-279501 CAGCTGCTCCGCGAGGTCCACGG - Exonic
1077047263 11:552091-552113 CAGCTGCTCGGGGGGCTCCCTGG - Exonic
1077057146 11:599715-599737 GTGCTGGTCCTGGGGCTCCAGGG + Intronic
1077799381 11:5522963-5522985 TAGCTGTTCCAGCTGCTCCAGGG + Intronic
1078191544 11:9095597-9095619 CATCAGCTCCTGGTGCTCCATGG - Intronic
1078264933 11:9747998-9748020 AAGCTGCTCCAGCTGCTCCATGG - Exonic
1080001317 11:27353429-27353451 CAACTGCTCCAGGTTCTCTATGG - Intronic
1080020109 11:27551367-27551389 CAGCTGCACCCATGGCTCCATGG - Intergenic
1081020371 11:37940176-37940198 CAGCTCCTCCAGAGGCAGCAAGG - Intergenic
1081812757 11:45922709-45922731 CACCTGCTCCAGCGGCTCCCGGG - Intronic
1083213934 11:61206788-61206810 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083216818 11:61225617-61225639 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083219700 11:61244443-61244465 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083474692 11:62908489-62908511 CACCTGAGCCAGGGACTCCACGG + Intergenic
1084218305 11:67663440-67663462 GGGCTGCTGCTGGGGCTCCATGG - Intronic
1084544425 11:69807612-69807634 AGGCCGCCCCAGGGGCTCCAGGG - Intergenic
1084782379 11:71418743-71418765 CTGCAGCTCCCGGGGCTCCTGGG - Intergenic
1084951144 11:72666191-72666213 CACCTGCTCTAGGGGCTGGAGGG + Intronic
1084977781 11:72812780-72812802 CAGCTGGCCCTGGGTCTCCATGG + Intergenic
1085529133 11:77181375-77181397 CAGCTGGGCCAGGCGCTCCTGGG - Exonic
1086312546 11:85550504-85550526 CAGCGGCACCAGTGGCACCAGGG - Intronic
1086948249 11:92865745-92865767 CAGTTGAGCCTGGGGCTCCATGG + Intronic
1087291254 11:96322952-96322974 CAGATTCTCCAGGGGTTCCAAGG - Intronic
1087682582 11:101233017-101233039 GCGCTGCTGCAGGGGGTCCAGGG + Intergenic
1088619860 11:111671027-111671049 CAGCTGCCCCAGCTCCTCCAGGG - Intronic
1089688245 11:120170251-120170273 CAGAGGGTCCAGGGGCTCCCGGG - Exonic
1089749325 11:120639286-120639308 CAGCTGCATCAGGGGCGCAATGG + Intronic
1089754291 11:120674956-120674978 CAGCAGCTCCAGGAGGTGCAAGG - Intronic
1090205313 11:124880515-124880537 CAGCAGCTCTAGGGGCTCCCGGG + Exonic
1090385262 11:126354848-126354870 CGGGAGCGCCAGGGGCTCCAAGG - Intergenic
1090583758 11:128187875-128187897 CAGATGTTCCAAAGGCTCCATGG - Intergenic
1090894059 11:130953615-130953637 CATGGGCTCCATGGGCTCCATGG + Intergenic
1091256591 11:134192796-134192818 CAGCTGGTCCAGGAACTCCAGGG + Exonic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1091906516 12:4193944-4193966 CAGCTTCTCCAGGTCCTCCACGG + Intergenic
1092134402 12:6136624-6136646 CAGCTCCACCAGGAGCACCAAGG + Intergenic
1092869010 12:12788812-12788834 CGGCTTCTCTAGGGACTCCATGG + Exonic
1092877116 12:12857799-12857821 CAGCTACTCCAGAGGCTGAAGGG + Intergenic
1094502594 12:31034457-31034479 CAGCAGGCCCATGGGCTCCAGGG - Intergenic
1095050357 12:37548562-37548584 CGGCAGCTTCAGGGGCTGCATGG + Intergenic
1095943428 12:47740512-47740534 CAGAGGCTCCAGGGGACCCAGGG + Intronic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1095983700 12:47986407-47986429 CAGCGGGTCCAGGGGCTCCCTGG + Exonic
1096089629 12:48890266-48890288 CAGCTCATCCACGGGCCCCAGGG - Intergenic
1096229009 12:49887270-49887292 CAGGTGCTCCCGAGGATCCAGGG + Intronic
1096519213 12:52174688-52174710 CAGCAGCAACAGGGGCTCCGGGG - Intronic
1096661989 12:53131369-53131391 CAGCTGCTCAAAACGCTCCAAGG - Intergenic
1096718674 12:53505747-53505769 CAGTTGCTCCCTGGGCTCCCTGG + Exonic
1097247511 12:57614684-57614706 CAGCTGCTGCCGGAGCTCCTGGG - Exonic
1097693643 12:62756926-62756948 CAGCATCTCCAAGGGCTCAAAGG + Intronic
1098293757 12:68983446-68983468 CAGCTGCTCCAAGAGATCAATGG - Intergenic
1099377003 12:81904133-81904155 GTGCTGCTGCAGGGGGTCCAGGG - Intergenic
1101603898 12:106233351-106233373 CCCCTGCTCCATGTGCTCCATGG + Intergenic
1101716983 12:107319980-107320002 CGTGTGCTCCAGGGTCTCCACGG - Exonic
1101813749 12:108129791-108129813 CAGCTGCTGCAGTGGCTTTAAGG - Intronic
1102351399 12:112194916-112194938 CAGCAGTTGCAGGTGCTCCAGGG + Exonic
1102679664 12:114682940-114682962 CAGATGCGCCTGGGGCCCCAGGG + Exonic
1102959775 12:117085044-117085066 CAGCTGGCCAAGGGGCACCAGGG + Intronic
1103678645 12:122676589-122676611 CAGCTCCACCTGCGGCTCCAGGG - Intergenic
1103896737 12:124278141-124278163 CGGCTGCTCCGGGGTCTCCAAGG - Intronic
1103972782 12:124682449-124682471 GAGCTGCTCCTGGGCCTCCCGGG + Intergenic
1104418418 12:128614979-128615001 CAGCTGCCCCAGGAGAACCAGGG + Intronic
1104897379 12:132171052-132171074 CAACAGCTCCACGGGCCCCAGGG - Intergenic
1105627796 13:22129979-22130001 CTTCTGCTCCAGGGGCACCAGGG - Intergenic
1105923624 13:24987026-24987048 CGGCTGACCCAGGGTCTCCATGG + Intergenic
1106035169 13:26037620-26037642 CAGCTGGTCCTGGTGCCCCACGG - Intergenic
1106421473 13:29589510-29589532 CAGCTGCCCCAAGGACCCCAGGG + Intronic
1108394458 13:49979140-49979162 CAGCTGCTTCAGGCCCTCCAGGG - Intergenic
1108500510 13:51065964-51065986 CAGCTGCTCCTGGGGCCACAGGG + Intergenic
1109425005 13:62156617-62156639 GTGCTGCTGCAGGGGTTCCAGGG - Intergenic
1110360761 13:74622364-74622386 CTGCTGCTTCAGAGGATCCATGG - Intergenic
1111397119 13:87677898-87677920 CAGGTCCTCCCGGGGCTCGATGG - Exonic
1112380112 13:98880914-98880936 CACCTGTGCCAGGGGCTTCAAGG + Intronic
1112397958 13:99050769-99050791 CAGCTGCTCTAGGGGATAGATGG - Intronic
1112398656 13:99056812-99056834 GAGCTGCTCCTTGGCCTCCAGGG - Intronic
1112468748 13:99668895-99668917 CAGATTCACTAGGGGCTCCAGGG + Intronic
1113248694 13:108427617-108427639 CAACTGCTGCAGGGGATCCAAGG + Intergenic
1113359258 13:109613783-109613805 CAGCTGATGCAGGTGTTCCAGGG - Intergenic
1113550706 13:111191067-111191089 GCGCTGCTGCAGGGGGTCCAGGG + Intronic
1113589582 13:111488992-111489014 CAGCTGCCCCAGGGGCACCTGGG + Intergenic
1113737714 13:112690189-112690211 CAGCTGCTCCACTGGCGGCAAGG - Intergenic
1113777233 13:112954700-112954722 CAGCTGCTCCAGGACCTCTGGGG + Intronic
1114653380 14:24300684-24300706 CAGCTCCTCCAGGGTCTCCGTGG - Exonic
1114999239 14:28401440-28401462 CAGCTGCTCCTGGGGGCCCTTGG + Intergenic
1117092972 14:52268575-52268597 CAGCTCCTCCAGGGGCTGAGGGG - Exonic
1118928153 14:70212967-70212989 CTGCTGCTCCTGGCCCTCCAGGG - Intergenic
1119030434 14:71188111-71188133 CAGCTTCTCCAGAGGCTGCAGGG + Intergenic
1119262228 14:73244680-73244702 CAGGGGCTCCACTGGCTCCAGGG - Exonic
1119743094 14:77026911-77026933 CTGCTCCCCCAGGGGCTCCTGGG - Exonic
1121232572 14:92368690-92368712 CAGCTGCTGCAGGGGCTCTGAGG + Intronic
1121434808 14:93912102-93912124 CAGTTGCACCAGGGACTCCAAGG + Intergenic
1122115858 14:99526889-99526911 CAGCAGCTCCAGGGGCAGCTGGG + Intronic
1122302808 14:100740726-100740748 CACCTGCTCCAGGTGCTGCACGG - Intergenic
1122325271 14:100877930-100877952 CAGCAGCTCCAGGAGCTCAAGGG - Intergenic
1122386530 14:101351996-101352018 CTGATGCTGCAGGGGCCCCAGGG - Intergenic
1122392047 14:101396329-101396351 GAGCTGCTCCAGGGGCCCTGAGG - Intergenic
1122479724 14:102039235-102039257 CACCTGCTTGAGGGACTCCATGG - Exonic
1122540124 14:102493427-102493449 CAGGGGATGCAGGGGCTCCAGGG - Intronic
1122691990 14:103535875-103535897 CGGCAGCTCCAAGGGCCCCATGG - Exonic
1122977092 14:105175203-105175225 CACCTCCTCCAGGGGGACCAAGG + Intronic
1123115829 14:105893652-105893674 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123117857 14:105902762-105902784 CAGCTGAGCCAGGGGCCCCCAGG + Intergenic
1123120071 14:105912367-105912389 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1202909723 14_GL000194v1_random:105456-105478 CAGCTGCTCCAAGAGATCAAAGG - Intergenic
1123402809 15:20003953-20003975 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123439649 15:20281259-20281281 CAGCTGTTCGAGGGGCTGCCTGG + Intergenic
1123512146 15:21010607-21010629 CAGCTGTGCCAGGGGCCCCCAGG + Intergenic
1123774648 15:23566346-23566368 CTGCTCCTCCAGCAGCTCCACGG - Exonic
1124439359 15:29675278-29675300 CAGCTGCTGCCGGGGGTCCTGGG + Intergenic
1126446555 15:48752400-48752422 CAGCAGGTCCAGGGTCTCCTTGG + Exonic
1126780564 15:52135680-52135702 CAGCTGCTGCAGAGCTTCCACGG - Exonic
1127146718 15:56032573-56032595 CTGCTGCTGCAGGGGCACCAGGG - Intergenic
1127284994 15:57524615-57524637 CAGCTGGTTCTGGAGCTCCAGGG - Exonic
1128143571 15:65319079-65319101 CAGAGGCTCCCTGGGCTCCAGGG + Intergenic
1128214265 15:65923437-65923459 CAGCAGCACCAGTGGCTCCTGGG - Intronic
1129320851 15:74773862-74773884 CAGCTGCTCCAGTGCCTGGAAGG + Intergenic
1129330742 15:74826057-74826079 TAGCTGCTCCAGGGGCAGCAGGG + Intergenic
1129831852 15:78675860-78675882 CAGCTGCTTGAGGGACACCAAGG + Intronic
1129878340 15:78991732-78991754 CAGCTGCTCCGCGATCTCCAGGG + Exonic
1130014344 15:80175377-80175399 CAGCCTCTCCAGGGGCTGCCTGG + Intronic
1130873863 15:87995166-87995188 CAGGTGCTCTCTGGGCTCCATGG - Intronic
1131091428 15:89627441-89627463 CAGCAGCTCAAGGGACCCCAGGG - Exonic
1131411735 15:92213205-92213227 GCGCTGCTGCAGGGGGTCCAGGG - Intergenic
1132115231 15:99131185-99131207 CAGCTGCTGCCGGGGCTCCTTGG - Exonic
1132224788 15:100132064-100132086 CACATGCTCCAGGCGCCCCACGG + Exonic
1132466613 16:80313-80335 CTGGTTCTCCAGAGGCTCCAAGG + Intronic
1132865282 16:2090128-2090150 TCGCTCCTCCAGGGGCTCCAAGG - Exonic
1132953495 16:2578324-2578346 CAGATGGTACAGGGGCTGCAGGG + Intronic
1132960857 16:2621843-2621865 CAGATGGTACAGGGGCTGCAGGG - Intergenic
1133002843 16:2859810-2859832 TGGCTGCTTCAGGGACTCCATGG + Intergenic
1133079282 16:3305677-3305699 CCGCCGCTCCAGCGGCTCCAGGG - Intronic
1133118303 16:3590748-3590770 CAGCTGCTCCAGCCCTTCCAGGG - Exonic
1133145736 16:3785196-3785218 AAGGTGCTCCAAGTGCTCCATGG + Intronic
1133344780 16:5062522-5062544 CGGCTGCAGCAGGGGCTCCTGGG + Exonic
1133852215 16:9516183-9516205 CACTTCCTCCAGGGGCTCTAGGG - Intergenic
1133854786 16:9539427-9539449 CACCCCCTCCAGAGGCTCCAAGG - Intergenic
1134039096 16:11054136-11054158 AAGGTTCTCAAGGGGCTCCAAGG - Intronic
1135328433 16:21542639-21542661 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1135990441 16:27215783-27215805 AAGCTGCCCCAGGGCCTCTAAGG + Intronic
1136103482 16:28012137-28012159 CAGCTGCTCCAAATGCCCCACGG + Intronic
1136115413 16:28091413-28091435 CAGCTGCTCTGGGGACACCAAGG - Intergenic
1136236879 16:28919795-28919817 CTGCTTCTCCAGGGAGTCCAGGG + Exonic
1136338780 16:29628612-29628634 CACCAGGTCCAGGGGATCCAGGG - Intergenic
1136371601 16:29840275-29840297 CCCCTCCTCCAGGGGCTGCAGGG - Exonic
1136412494 16:30085501-30085523 CAGCTTGCCCAGGGCCTCCAGGG + Intergenic
1136557215 16:31014488-31014510 CTGGTTCTCCAGTGGCTCCACGG + Intergenic
1137337704 16:47566654-47566676 CCACTGCTCCAGGGGCTGCTTGG - Intronic
1138494074 16:57396580-57396602 GCGCTGCTGCAGGGGGTCCAGGG + Intergenic
1138575158 16:57903039-57903061 GAGCTGCCCCAGGAGATCCAGGG + Intronic
1139472754 16:67187048-67187070 CAGCTGCTCAATGTTCTCCAAGG + Exonic
1139475731 16:67201737-67201759 CAGCTGCTCCCGCTGCTCCTGGG - Exonic
1140218882 16:73029196-73029218 CACCTGCTCCTGGGACCCCAAGG + Intronic
1140804854 16:78523781-78523803 CAGCTGTTCCAGAGGCCCCCAGG - Intronic
1140887537 16:79258324-79258346 CACCTGCTCCATGGGGACCAGGG + Intergenic
1140991048 16:80211924-80211946 CAGCTTCTCCAGGGTCCCCTAGG - Intergenic
1141125397 16:81397424-81397446 CAGCAGCTCCAGAAGCTGCAAGG + Intergenic
1141461999 16:84183277-84183299 CAGCTTCCCCAGGGGCGCAAAGG + Exonic
1141695283 16:85616200-85616222 TACCTGCTCCAGGGGCTCAAGGG - Intronic
1141716513 16:85730087-85730109 CAGCTCCCCCAGGGGCTCTGAGG - Intronic
1141993079 16:87621384-87621406 CGGCTGCGCAAGGGGCTTCAGGG + Intronic
1142041463 16:87897177-87897199 CACCAGGTCCAGGGGATCCAGGG - Intronic
1142100198 16:88266976-88266998 CTGCTGCTCCAGGGCCCCCCTGG - Intergenic
1142110626 16:88329216-88329238 CAGGTGGTGAAGGGGCTCCAGGG + Intergenic
1142136311 16:88453462-88453484 CGGCAGCTCCAGCGGCTCCGGGG + Exonic
1142144555 16:88487504-88487526 CAGCAGGTCCAAAGGCTCCAAGG + Intronic
1142247231 16:88975730-88975752 CAGCTGCCCGTGGGGCCCCAGGG - Intronic
1142306531 16:89289101-89289123 CAGGAGCTCCAGGGGCGCCCAGG + Intronic
1142432583 16:90037984-90038006 AAGCTGGTCCAGGGGCCACAAGG - Intronic
1142711707 17:1727139-1727161 CAGCTCCTCCAGGGCCTGCATGG - Exonic
1142964879 17:3574378-3574400 CAGCTGCTGCAGAGGCTCTCAGG - Intronic
1142984988 17:3690234-3690256 CAGAGGCTCCAGGGGACCCAAGG - Intronic
1143285730 17:5787863-5787885 CAGCTACTCCAGAGGCTGAAGGG - Intronic
1143291153 17:5830170-5830192 AAGCTGCTCCAGGTGGTCCAGGG - Intronic
1143628003 17:8122012-8122034 CCGCGGCTCCAGGGGTTCCCCGG - Exonic
1143863047 17:9905130-9905152 CAGCTCCTCCAGGATCTCCTTGG + Exonic
1144062770 17:11598658-11598680 CAGCTGCTCCAGGCCTTCCTGGG + Exonic
1144246614 17:13372532-13372554 CAGGATATCCAGGGGCTCCAGGG - Intergenic
1144673078 17:17143861-17143883 CAGCAGAACCAAGGGCTCCATGG + Intronic
1144763529 17:17720889-17720911 CCACTGCCCCAGGAGCTCCAGGG + Intronic
1144969027 17:19095542-19095564 CAGCTGCTAGAGGGGGTCTAAGG + Intronic
1144978889 17:19156524-19156546 CAGCTGCTAGAGGGGGTCTAAGG - Intronic
1144989333 17:19221708-19221730 CAGCTGCTAGAGGGGGTCTAAGG + Intronic
1145209331 17:21001675-21001697 CAGATGCTGCTGGGGCTCCTGGG + Exonic
1145291975 17:21554033-21554055 CTGCTGCTCCAGGGGCTGCAGGG - Intronic
1145388075 17:22432967-22432989 CTACTGTTCCAGGGGCTGCAGGG + Intergenic
1145792044 17:27633419-27633441 CCGCTGCCTCAGAGGCTCCATGG - Intronic
1145804852 17:27719322-27719344 GCGCTGCTGCAGGGGGTCCAGGG - Intergenic
1146311266 17:31770195-31770217 GTGCTGCTGCAGGGGGTCCAGGG - Intergenic
1146948247 17:36888697-36888719 CAGCTGCCCCAGGGGCTTAAGGG + Intergenic
1147562101 17:41515613-41515635 CAGCAGATCCAGGGGCTCATTGG - Exonic
1147725125 17:42562276-42562298 AAGCTGCACCAGGGTCTTCAAGG - Intronic
1148795854 17:50196313-50196335 CAGCAGGGCCAGGGGCTCCAGGG + Exonic
1148796213 17:50198160-50198182 CAGGTGCACCAGGGGGGCCAGGG + Exonic
1150209290 17:63433467-63433489 CAGCAGCTCCAGCAGCCCCAGGG + Exonic
1150249647 17:63698864-63698886 CAGCCGCTCCATGGGGTACACGG + Exonic
1150782564 17:68134903-68134925 CAGCTGGTCCAGGATCTGCACGG + Intergenic
1151252174 17:72844848-72844870 CTGCAGCTCCAGGGGCTTTAGGG - Intronic
1151323598 17:73365867-73365889 CCTCTCCTCCTGGGGCTCCAGGG + Intronic
1151464786 17:74277557-74277579 CTGCTGCCCCAGCTGCTCCAGGG + Intronic
1151977947 17:77492903-77492925 CAGCTCCTCCCGGGGGCCCAGGG + Intronic
1152101010 17:78301776-78301798 TAGCTGCTCCAGGGCCCTCAGGG - Intergenic
1152217738 17:79044183-79044205 TAGCTCCCCCAGGGGCCCCAAGG - Intronic
1152579910 17:81161276-81161298 CAGCGGCCCCAGGTGCTCCTGGG + Intronic
1152587095 17:81193979-81194001 CAGCTGCTCCCGCAGCTCCTCGG + Exonic
1152588139 17:81198205-81198227 CAGCTCCTCCAGTGGCCCCCTGG + Exonic
1152661958 17:81546648-81546670 CAGCTGCTCCTGGGGCATCCTGG - Intronic
1152826073 17:82465677-82465699 CAGCTGCTCTGGAGGCTACAGGG - Intronic
1152920509 17:83064275-83064297 CAGATGGTGCAGGGGCTGCAGGG - Intergenic
1153667257 18:7377154-7377176 AAGCTGCTCAAGGGGGTCCTGGG + Intergenic
1154176925 18:12092026-12092048 CAGCTGCTCCAGGTTCTGCAGGG + Intergenic
1155057529 18:22197971-22197993 CAACTGCCCCAGGAGCTCCCAGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156498958 18:37544910-37544932 GAGCTGATCCTGGGGCTCCAGGG + Intronic
1157962817 18:52175761-52175783 CAGCTCCTCCTTAGGCTCCATGG - Intergenic
1158212882 18:55070075-55070097 CATCTGCTTCAAGGGCTCCGGGG - Intergenic
1158887399 18:61841057-61841079 CTGCTGCTCCATGTGCCCCATGG - Intronic
1159138948 18:64369484-64369506 CAGCTGCTCCTGGGGGCCCTTGG + Intergenic
1160250910 18:77202798-77202820 CAGCAGCTCCACCAGCTCCAGGG - Intergenic
1160310704 18:77787244-77787266 CGCCTGCAACAGGGGCTCCATGG - Intergenic
1160702171 19:512909-512931 CAGCGGCTGCAGGTGCTCCCTGG - Intronic
1160906245 19:1453012-1453034 CAGCTGCTCGTAGGGCGCCACGG - Exonic
1160948063 19:1652492-1652514 CCGCTGCCCCAGGGGCGCCCCGG - Intronic
1160993610 19:1871854-1871876 GAGCTGCTTCAGGGACACCAAGG + Intergenic
1161121724 19:2530754-2530776 CATCTGCTCAAGGGCCTGCAGGG + Intronic
1161170535 19:2810443-2810465 GAGCTTCTCCAGGAGCTCCCGGG - Exonic
1161233908 19:3188725-3188747 CAGCTGGTCCGTGGGCTCCCGGG + Intronic
1161337035 19:3720253-3720275 CAGCCCCTCAAGGGTCTCCAAGG - Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161581243 19:5082219-5082241 AAGGTGATCCAGCGGCTCCAGGG - Intronic
1161756689 19:6138889-6138911 CAGCTGCTCCAGAGGGGCCTTGG + Intronic
1162236752 19:9315628-9315650 GCGCTGCTGCAGGGGTTCCAGGG + Intergenic
1162351304 19:10151370-10151392 GAGCTGACCAAGGGGCTCCAAGG + Intronic
1162401746 19:10450850-10450872 CAGCTCCTCCAGAGTCTCCCGGG - Exonic
1162703909 19:12541134-12541156 CAGCTACTCAAGAGGCTCGAGGG + Intronic
1162760422 19:12885559-12885581 CAGCTCTTCCGCGGGCTCCAGGG - Exonic
1163274258 19:16273175-16273197 CTGCGGCTGCCGGGGCTCCAAGG + Intergenic
1163490888 19:17616662-17616684 CTCCTGCTCCAGGGACACCAGGG + Intronic
1163602882 19:18259289-18259311 GAGCTGCTCCAAGGGGCCCATGG - Intronic
1165509553 19:36258058-36258080 CAGCAGCTTCAGGGGCTGCCTGG + Intergenic
1166204402 19:41259718-41259740 CAGCTCCTCCTGCAGCTCCAGGG - Exonic
1166574224 19:43822150-43822172 CAGCCACTCCATGGGCTACAGGG - Intronic
1166736723 19:45090263-45090285 CCGCTGCTCCTGGGATTCCAGGG - Exonic
1166762600 19:45234420-45234442 CAGCGGCTCCCGGGGCGCCCGGG - Intronic
1167261666 19:48462427-48462449 CAGCTGCTGCAGGTGCGCCCGGG + Exonic
1167281816 19:48573598-48573620 CAGCAGCTCCAGGGGCCCAGAGG + Intronic
1167508003 19:49881278-49881300 CAGCTGCCCCCAGGGCTCCTGGG + Exonic
1167613458 19:50518219-50518241 CTGCGTCTCCAGGGTCTCCACGG + Exonic
1167613620 19:50519011-50519033 CAGCTCCTCCAGGCGCACCAGGG + Exonic
1167649375 19:50721102-50721124 CAGCACCTCCAGGGCCTGCAGGG + Intergenic
1168128079 19:54298285-54298307 CTGGTGCTCTTGGGGCTCCAGGG + Intergenic
1168231126 19:55032335-55032357 TGGCTTCTCCAGGGGCACCAGGG + Exonic
1168277427 19:55285357-55285379 CAGAGGCTGGAGGGGCTCCAGGG + Intronic
1168287789 19:55343019-55343041 CTCCTGCTCCAGCGGCACCACGG - Intronic
1168666196 19:58206987-58207009 GAGCTGGTCCAGGGCCTCCCGGG - Exonic
925133793 2:1512607-1512629 CAGCTGCTTGAGGGGCTGCAGGG - Intronic
925467842 2:4125618-4125640 CAGCAGCTCTAGGGGAACCAAGG - Intergenic
926953675 2:18271548-18271570 CACCTGCTCCAGGGGCCTGAAGG + Intronic
927703422 2:25282441-25282463 CCGCTTCTGCAGGGGCTCCTCGG + Exonic
927718404 2:25367514-25367536 CAGCTGCTCCAGGGCGGCCATGG - Intergenic
928003590 2:27542978-27543000 CAGCTACTCCAGAGGCTCCCAGG + Intronic
928314995 2:30238061-30238083 CAGCTGCTTCTTTGGCTCCAGGG + Intronic
930866319 2:56125626-56125648 CAGAAGCCCCAGGGGTTCCAGGG + Intergenic
931425653 2:62168817-62168839 CTGCTGCACCAGGGGTTTCAGGG - Intergenic
931924361 2:67055031-67055053 TAGCAGCTCCAGTGTCTCCATGG - Intergenic
932354727 2:71059327-71059349 GAGCTGATACAGGGACTCCATGG + Intergenic
932574318 2:72954505-72954527 CAGCTGTTGCAGGGGCCCCTGGG - Intronic
932743745 2:74313892-74313914 CAGCTGCCCTAGGTGCTCCCTGG + Intronic
933141756 2:78800111-78800133 AAGCTGCTGAAGGGGCTACATGG - Intergenic
933161205 2:79026750-79026772 CAGCTGTCCCAAAGGCTCCAAGG + Exonic
934555621 2:95285672-95285694 CAGCTGGCCCAGGAGCTGCAAGG + Exonic
934711120 2:96514838-96514860 CAAGGGCTCCAGGGACTCCAGGG + Intergenic
934790621 2:97056788-97056810 AAGCTGCTACAGGGGCTCCAGGG - Intergenic
934815838 2:97325741-97325763 AAGCTGCTCCAGGGTCTCCAGGG + Intergenic
934821857 2:97382742-97382764 AAGCTGCTCCAGGGTCTCCAGGG - Intergenic
936259177 2:110943500-110943522 AAGCTTCCCCAGGTGCTCCAGGG - Intronic
936370030 2:111896226-111896248 CAGCTACTCCAAGGCCACCATGG + Intergenic
937438054 2:121895618-121895640 CATCAGCTCCAGGGGCTCTCAGG + Intergenic
938164266 2:129012184-129012206 GAGCTGAGCCAGAGGCTCCAGGG - Intergenic
938368819 2:130756214-130756236 CCGCGGCTCCAGGGGCCCCGCGG - Intronic
938893979 2:135732857-135732879 AAACTGCTGCAGGGCCTCCACGG + Intergenic
939068911 2:137516643-137516665 CAGTGGCTCCAGTGGGTCCACGG + Intronic
940020134 2:149147625-149147647 CAGCTACTCCAGAGGCTGCAGGG - Intronic
940756910 2:157693817-157693839 AAGCTGCTCCAGGGGCATCTTGG - Intergenic
944436187 2:199692598-199692620 CTTCTGCCCCAGGGGCTTCATGG + Intergenic
945093834 2:206200709-206200731 CAGCTACTCCAGAGGCTGAAAGG - Intronic
945267555 2:207905824-207905846 AAGCTGCTTATGGGGCTCCAGGG + Intronic
946104688 2:217358808-217358830 CAGGTGATTCAGGGGGTCCATGG + Intronic
946159363 2:217826696-217826718 CAGCTGCATCAGAGGCTACAGGG + Intronic
946987021 2:225284804-225284826 GAGCTACTCCAGGGGCTGAAGGG - Intergenic
947039068 2:225894557-225894579 GAGCAGCTCCGGGGGCTCCAGGG + Intergenic
947072591 2:226307450-226307472 CAGTTGCTCCAGGAGACCCAGGG - Intergenic
947525095 2:230872777-230872799 CAGGGGCTCCAGGAGCCCCATGG - Intronic
947913115 2:233814598-233814620 CAGCTGCTCCAGGGAGCTCAGGG - Exonic
948207933 2:236172782-236172804 CCGCCGCCCCAGGGGCTCCGGGG - Intergenic
948289784 2:236816500-236816522 CAGCAGCGCCAGGGTCTCCTAGG - Intergenic
948517108 2:238510992-238511014 GAGCTGCTCCCGGAGCTCCTGGG + Intergenic
948529774 2:238597047-238597069 GAGCTGGTCCAGGGGGTCCCCGG + Intergenic
948536290 2:238650185-238650207 CAGCTGGCTGAGGGGCTCCAGGG + Intergenic
948850081 2:240701544-240701566 GCGCTGCTCCAGCGGCTCCTGGG + Intergenic
948853681 2:240720293-240720315 CCTCTGCTCCAGTGGCTCCTTGG - Intronic
948871263 2:240799392-240799414 CAGCTCTTCCAGAGGCTACAGGG + Intronic
1169122863 20:3107749-3107771 CTGCCACTCCAGGGGCTCCCAGG + Exonic
1169200209 20:3705611-3705633 AGGCTGCTCCTGGGCCTCCAGGG - Intronic
1171091634 20:22290850-22290872 CAGGGTCTCCAGGTGCTCCAGGG - Intergenic
1172517020 20:35542096-35542118 CAGCTTCCCCAGCGCCTCCATGG - Exonic
1172888122 20:38245530-38245552 CTGATGCCTCAGGGGCTCCAGGG + Intronic
1173617733 20:44413878-44413900 CAGCTGCTCCAGGGCCTGGCTGG - Intronic
1173737987 20:45375201-45375223 CAGCTGCTTCATGTGCCCCATGG + Exonic
1173858548 20:46267238-46267260 CACCTGCTCCAGAGGCTCTCAGG - Intronic
1174112261 20:48204984-48205006 CAGCAGCTCCAGGGGGCTCACGG - Intergenic
1174126394 20:48310073-48310095 CAGCAGCTACTGGGGCTCCTGGG + Intergenic
1174193645 20:48757742-48757764 GAGCTGGTCCAGGGGCTACACGG - Intronic
1174280109 20:49433142-49433164 CTGCTGCCCTAGGGGCTCCTGGG - Intronic
1174677738 20:52374695-52374717 CAGCTGCTCCCTTGGCTGCACGG + Intergenic
1175092702 20:56518199-56518221 CAGCTCCGCCAAGCGCTCCAAGG + Exonic
1175276369 20:57773898-57773920 CCCCAGCTCCAGGAGCTCCAGGG - Intergenic
1175555238 20:59848361-59848383 CAGTTGCTCCAGGTGCTACCTGG - Intergenic
1175736651 20:61391874-61391896 CAGCAGCTCCGGGGCCTGCAGGG + Intronic
1175869372 20:62200977-62200999 CAGCTGCTCCAGGTTCTCGCCGG - Exonic
1175873201 20:62217995-62218017 CAGCGGCTCCCTGGGCTGCATGG + Intronic
1176116368 20:63433246-63433268 CTGCTGCCCGAGGGGCTCCAAGG + Intronic
1176366945 21:6039126-6039148 CACCTGCTGCAGGGGCCCCGGGG - Intergenic
1179567086 21:42256000-42256022 CTACTGCTCTAGGGGCTCCCTGG - Intronic
1179726930 21:43346061-43346083 GAGCTGATGCAGGGGCTCCCTGG + Intergenic
1179732094 21:43373749-43373771 GTGCTGGGCCAGGGGCTCCAAGG - Intergenic
1179756573 21:43499420-43499442 CACCTGCTGCAGGGGCCCCGGGG + Intergenic
1179996121 21:44975259-44975281 CACCAGCTCCAGGAGCTACAAGG - Intronic
1180166365 21:46032746-46032768 CATCCCCTCCTGGGGCTCCAGGG - Intergenic
1180228296 21:46411520-46411542 GCGCTGCTGCAGGGCCTCCAGGG - Exonic
1180326456 22:11434504-11434526 CAGCTGCTCCAAGAGGTCAAAGG + Intergenic
1180621972 22:17168480-17168502 CAGCTACTCCAGAGGCTGAAGGG - Intergenic
1180846542 22:18985923-18985945 CAGCTGCTCCGGCGCCTCGAGGG + Intergenic
1181116448 22:20635050-20635072 CTGCTGCCCCAGGCGCTCCCTGG - Intergenic
1182350621 22:29697339-29697361 CAGAAGCACCTGGGGCTCCAGGG + Exonic
1182444131 22:30380384-30380406 CAGCTGCTGCAGGGGTTTCTGGG + Exonic
1182688874 22:32142065-32142087 CAGCTGCCCAGTGGGCTCCATGG - Intergenic
1182832662 22:33316234-33316256 CAGCTGCTTCTGGAGCTGCAGGG + Exonic
1183187433 22:36300081-36300103 CCGCTGCTCCAGGGGCGCCGTGG - Intronic
1183253606 22:36746707-36746729 CAGCCTCTCCAGGGCCTCCTCGG - Intergenic
1183411729 22:37658901-37658923 CAGCCGCTCCAGCAGCTCCGGGG - Exonic
1183819158 22:40330822-40330844 CAGCTGCTCCTGGGACTTCCAGG - Exonic
1184173907 22:42775220-42775242 CACCCACTCCAGGGCCTCCAGGG + Intergenic
1184433970 22:44458830-44458852 CAGCTTCTGCATGAGCTCCAGGG + Intergenic
1184580520 22:45413547-45413569 CAGCAGCTCCAGGTGGGCCATGG + Exonic
1184657148 22:45947594-45947616 CAGCTCCTCCAGGTGCACCTTGG - Intronic
1184733872 22:46386476-46386498 CAGCTGCTCCGGCGCCTCGAGGG - Exonic
1184850444 22:47116650-47116672 CAGCTGCTGGATGGGCTGCATGG + Intronic
1184886179 22:47345625-47345647 CAGGGGCTCCAGGGGTTCCTTGG + Intergenic
1185030987 22:48442824-48442846 CAGCTGCAGCAGGAGCTCCCGGG + Intergenic
949918859 3:8985816-8985838 CGGGTTCTTCAGGGGCTCCAGGG + Exonic
950214725 3:11151361-11151383 CAGATGCTTCAGAGGCTCAAAGG - Intronic
950412190 3:12846239-12846261 CAGCTGCTCCAGTGGCTAAAAGG + Intronic
950573712 3:13817988-13818010 CAGCTGTGCAAGGGGCCCCATGG + Exonic
950585612 3:13890302-13890324 CTCCTGCTCCAGGGGCTTCCTGG - Intergenic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
950810542 3:15646261-15646283 CAGCTCATCCAGGGATTCCAGGG + Intergenic
951420593 3:22479612-22479634 CAGGTTCTCCTGGGTCTCCAGGG + Intergenic
952901513 3:38114716-38114738 CAACTGTGCCAGGGGCCCCAGGG - Intronic
954217963 3:49134858-49134880 CTGCTGCTCCAGGGCCTGCAGGG + Intergenic
954291655 3:49653142-49653164 GAGCTGCTCCAGAGGCAGCAAGG + Exonic
960724751 3:120658890-120658912 CAGCTCCTCCTGTGGCTCAAAGG - Intronic
961013158 3:123448990-123449012 CAGCTGCTCTCGGGGCTCGGCGG + Exonic
961125306 3:124412228-124412250 CTGCTGCTCCAGGAGCATCAGGG - Intronic
961336055 3:126180387-126180409 CGGGGGCTCCGGGGGCTCCAGGG - Intronic
961336059 3:126180396-126180418 CTGCAGCTCCGGGGGCTCCGGGG - Intronic
961380388 3:126492802-126492824 CAGATGGCTCAGGGGCTCCAAGG - Intronic
961523372 3:127481214-127481236 AAGGGGCTCCATGGGCTCCAGGG - Intergenic
961558844 3:127714984-127715006 CAGCAGCGCCAGGGGCTCCAGGG + Intronic
963923647 3:150929059-150929081 GGGCTGGTCCAGAGGCTCCAAGG - Intronic
964569277 3:158094728-158094750 CCCCTGCTCCAGGGTCTCCAGGG + Intergenic
965261247 3:166489223-166489245 CAGCTGCACCTGGGGTTACAGGG - Intergenic
967154725 3:186681898-186681920 CTTCTTCTCCAGGGACTCCAGGG + Intergenic
967890470 3:194360935-194360957 TACCTGCTCCAGGGCCTCCCAGG - Exonic
967943761 3:194786309-194786331 GAGCTTCTCCAGGGCCTTCAAGG - Intergenic
967990583 3:195127329-195127351 CAGTTCCTCCAGGGGTGCCATGG + Intronic
968698591 4:2044225-2044247 CAGCTGCTCTGGGGGCTCAGGGG - Intergenic
968704835 4:2072992-2073014 CACCTGTTCCAAGGACTCCATGG + Exonic
968775263 4:2536448-2536470 CAGCTGCTGCACGGGCAGCACGG + Intronic
968793968 4:2689777-2689799 CAGCTGCGCCAGGGCTTCCACGG - Intronic
968850549 4:3074824-3074846 CAGCTTTTCCAGGGTCGCCATGG - Exonic
968934110 4:3601092-3601114 CTGCTCCTCCAGGTGCTCCCAGG - Intergenic
969256987 4:6008890-6008912 CAGCTGCTCCAGAGCCTCCCAGG + Intergenic
969281865 4:6176246-6176268 CAGCTGCTCCAGAGTCAACATGG + Intronic
969392400 4:6900597-6900619 CTGCTGTTCCTGGGCCTCCAGGG + Intergenic
969463033 4:7338844-7338866 CTGTTGCTCCTGGGCCTCCAAGG + Intronic
970106842 4:12595133-12595155 CAGCAGCTCCTGGAACTCCACGG + Intergenic
970318853 4:14855946-14855968 CAACTGCTCCTGGTTCTCCAAGG - Intergenic
973643991 4:52931950-52931972 CAGCTGCAGCAGAGGCCCCAGGG + Intronic
975329620 4:73099317-73099339 CAGCCACTGCAGGGGCCCCATGG + Intronic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
980168033 4:129252242-129252264 CAGCTGCTCCAATGGCTAAAAGG + Intergenic
981141570 4:141275656-141275678 CTGCTGCTGCAGAAGCTCCAAGG + Intergenic
984292568 4:177813813-177813835 CAGCTCCTTCAGTGGCTGCATGG + Intronic
985553809 5:546413-546435 CAGCTGCTCCAGACCCTGCAGGG - Intergenic
985651172 5:1108456-1108478 CAGCTGCTGCAGGGGCTCCCGGG + Intronic
985723676 5:1504346-1504368 CACCTGGTCCCGGGGCTCCAGGG + Intronic
985764147 5:1768084-1768106 CAGCTGCACCCGGGGGTCCCTGG - Intergenic
985775882 5:1841479-1841501 CCGCTGCTCCAGGGCCTGGACGG + Intergenic
985888444 5:2697956-2697978 CAGCAGCTCGAGGGGCCACAGGG + Intergenic
985947190 5:3194972-3194994 CACCTTCTGCAGGGGCTGCATGG - Intergenic
986152377 5:5139887-5139909 CAGCTACTGCAGTGGCTCCGCGG - Intergenic
990540924 5:56771710-56771732 CAGCTGATCCTGGGGATCCCGGG - Intergenic
990753000 5:59038928-59038950 CAGCTCCTCCAGGGTCTCGCTGG + Exonic
990996455 5:61736876-61736898 CAGTTGTGCCAGGGTCTCCATGG - Intronic
994122671 5:96134481-96134503 CAGCTGCTCCTGGGCCTTTAGGG + Intergenic
994794994 5:104286076-104286098 CAACTGTTCCAGGGGTTCCCAGG - Intergenic
995353133 5:111205350-111205372 CAGCTCCTCCAGAGGGACCAAGG + Intergenic
995397160 5:111699204-111699226 TAGCTGCTCCAGGGGCTGGCTGG - Intronic
997229821 5:132234220-132234242 CAGCTGCTGCAGTGGTTCCAGGG - Intronic
997963104 5:138337700-138337722 CAGCTGCAAGAGGGGCTCCTGGG + Intronic
998351036 5:141501485-141501507 TATCTGCTGCTGGGGCTCCAAGG + Intronic
998428029 5:142046469-142046491 CAGCTGCTCCAGGACCAACATGG - Intergenic
998642919 5:144032387-144032409 TTGCAGCTCCTGGGGCTCCATGG + Intergenic
998713119 5:144849154-144849176 GCGCTGCTGCAGGGGGTCCAGGG + Intergenic
999068107 5:148713967-148713989 CAGCAGCTCCAGAGACTCCAAGG + Intergenic
1002175285 5:177398120-177398142 GAGGTGGTCCAGGGGCTTCAGGG - Exonic
1002535744 5:179874461-179874483 CAGCTGTTCCAGCGGGCCCAGGG + Intronic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1002853799 6:1020388-1020410 CAGCTCCTCCAGGGCCCCTATGG + Intergenic
1003054172 6:2804004-2804026 CAGCTCCTCCTGGGGCTACCTGG - Intergenic
1003400514 6:5786806-5786828 CTGCTGACCCAGGGTCTCCATGG + Intergenic
1004170465 6:13291873-13291895 CTGCTGCTCCAGGGGCCCCCTGG - Intronic
1004532074 6:16462962-16462984 GTGCTGCTGCAGGGGGTCCAGGG - Intronic
1004977469 6:20984386-20984408 AAACTGCTGCAGGGCCTCCATGG - Intronic
1005781772 6:29200868-29200890 TCCCGGCTCCAGGGGCTCCACGG - Intergenic
1006020774 6:31116450-31116472 AGGCGGCTCCACGGGCTCCAAGG - Exonic
1006295669 6:33168963-33168985 CACCTTCTCCAGGGGGGCCAGGG + Exonic
1006375007 6:33667178-33667200 CAGCTCCTCCAGCCGCACCAGGG - Exonic
1006516946 6:34550468-34550490 CTGCTTCCCCAGGGTCTCCAAGG + Intronic
1006874245 6:37281611-37281633 CAGCTGCTCCAAGGACTAAAAGG - Intronic
1007122918 6:39398390-39398412 CAGCTGCTCCAGGGTCTAACAGG + Intronic
1007255135 6:40523102-40523124 CTGTTGCTTCAGGGGCTCAAGGG + Intronic
1007256944 6:40536180-40536202 CAGGTGCTCCAGCAGCTCCCAGG + Intronic
1009928643 6:70149876-70149898 CAGGAACTCCAGGGACTCCAGGG + Exonic
1010054656 6:71551369-71551391 CACTTGCTCCAGTAGCTCCAGGG - Intergenic
1010181915 6:73096462-73096484 CAGCTCCTCCATGGCCTGCAGGG - Intronic
1011742498 6:90376402-90376424 CGGCTGCTCCTAGGGGTCCAGGG + Intergenic
1012474257 6:99603574-99603596 CACCAGCACCAGGGTCTCCAAGG + Intergenic
1014272225 6:119348640-119348662 CAGCTTCTGCAGGGTCTCCTTGG + Exonic
1016948986 6:149562177-149562199 CAGGAGCTAGAGGGGCTCCAGGG - Intergenic
1016990519 6:149925082-149925104 GAGCTGCTCCTGGAGTTCCAAGG - Intergenic
1017004318 6:150019361-150019383 GAGCTGCTGCTGGGGTTCCACGG - Intronic
1018058584 6:160072323-160072345 CAGCAGCTCTAGGCTCTCCAGGG + Intronic
1018430133 6:163715696-163715718 CAGCAGCTCCAGTGGCTTCCAGG + Intergenic
1018889117 6:167969127-167969149 CAGCTGCTCCAGTAGATCCTGGG - Intronic
1019049107 6:169169788-169169810 CAGCAGCTCCAGAGGTTACAGGG + Intergenic
1019172095 6:170138341-170138363 ACGGTGCTCCAGGTGCTCCAGGG + Intergenic
1019261401 7:83984-84006 GAGCCCCTCCCGGGGCTCCAGGG + Intergenic
1019288502 7:235666-235688 CGGCTGCTCCAGCAACTCCAAGG - Intronic
1019716489 7:2541727-2541749 CAGCTCCTCCAGGTGAGCCAGGG + Exonic
1020012941 7:4816316-4816338 CAGCTGCCGCAGGAGGTCCAGGG + Exonic
1021937047 7:25641271-25641293 AAGTTACTCCAGGAGCTCCAAGG + Intergenic
1022723134 7:32958009-32958031 CCGCTGCTCAAGGTCCTCCAAGG - Intronic
1023866612 7:44241447-44241469 CAGCTCCTCCAAGGGCTGCTAGG + Intronic
1025296263 7:57777144-57777166 CAGCAGCTTCAGGGGCTGCCTGG + Intergenic
1025798123 7:64758785-64758807 GCGCTGCTGCAGGGGGTCCAGGG + Intergenic
1026010148 7:66629532-66629554 CATCAGCTCTCGGGGCTCCAGGG - Intronic
1026841241 7:73671009-73671031 CAGCTGCTCCATCTGCTCCTGGG - Exonic
1027682127 7:81233794-81233816 CAGCTGCTGCAGGGGAGGCATGG - Intergenic
1028508794 7:91598995-91599017 CAGCTGGTGCAGAGGCCCCAAGG + Intergenic
1029100826 7:98128690-98128712 CCTGTGCTCCAGGGGCTCCCTGG + Intronic
1029112156 7:98217933-98217955 CACCTGGTCCAGGGGCCCCACGG + Exonic
1029280051 7:99429687-99429709 CAGCTGCTGCCGGAGCTTCAGGG + Exonic
1029442555 7:100595171-100595193 CTGCTGGTCCAGGGGGTCAAAGG - Exonic
1029586105 7:101472645-101472667 CAGCTGCTCCATGCTCTCCTGGG - Intronic
1029708485 7:102287344-102287366 CAGCTGCTCCAGAGGCGGCTCGG - Intronic
1031086330 7:117305050-117305072 CCCTTGCTGCAGGGGCTCCAAGG + Intronic
1032145446 7:129375710-129375732 GAGCTGCTTCAGGGATTCCAAGG + Intronic
1032192520 7:129772929-129772951 CAGACACTCCAGAGGCTCCAGGG + Intergenic
1032269772 7:130393914-130393936 CAGGTGCTCCAGGGCTTCCGAGG - Exonic
1033446420 7:141426412-141426434 CAACTGCTCCAGGAACCCCAAGG + Intronic
1034346776 7:150390260-150390282 CCTCAGCTCCAGGGCCTCCAGGG + Intronic
1034385044 7:150734003-150734025 CAGCTGCTGAAGAGGCTTCACGG - Intronic
1035166426 7:156993128-156993150 CAGCTGCTCCAGCTGCCCCTAGG - Intergenic
1035381322 7:158443245-158443267 CAGCGGCTCCCGCGGCTCCAGGG + Intronic
1035812495 8:2504403-2504425 CTGCTGTTCCAGGGCCTCCCTGG + Intergenic
1036392844 8:8339517-8339539 CAGCTTCACCACCGGCTCCACGG - Exonic
1036558803 8:9884188-9884210 CAGCTCCTCCAGGGTTCCCAGGG - Intergenic
1036608479 8:10329289-10329311 CTGCTCCCCCAGGGGCTCCAGGG + Intronic
1036754392 8:11462790-11462812 CATCTGCTCCAGAGGCAGCAGGG + Intronic
1036788776 8:11704251-11704273 CTGCAGCTCCGGGGGCTCCCAGG + Exonic
1037628597 8:20631301-20631323 CAGCACAGCCAGGGGCTCCAAGG + Intergenic
1037814974 8:22107328-22107350 CAGCTCCTCCAGCGGCTTCAGGG - Exonic
1038147896 8:24914803-24914825 CTGCCGCTCCAGGGACTCCTTGG - Exonic
1038430218 8:27493993-27494015 GCGCTGCTGCAGGGGGTCCAGGG + Intronic
1039399077 8:37253321-37253343 GAGAGGGTCCAGGGGCTCCATGG + Intergenic
1039473471 8:37827438-37827460 CACCTGCCCCTGGGGCTGCAGGG - Intronic
1040518188 8:48151504-48151526 CACCTGCTCCAGGCGATCCTGGG - Intergenic
1041439398 8:57877726-57877748 CAGCTGGTCCTGGGGCCCAAAGG - Intergenic
1042920176 8:73912451-73912473 GCGCTGCTGCAGGGGCTCCAGGG - Intergenic
1044004799 8:86927321-86927343 GCGCTGCTGCAGGGGGTCCAGGG + Intronic
1044680749 8:94775141-94775163 CAGCTGATCTAGGGGCACAATGG - Intronic
1045273439 8:100680971-100680993 CAGCTGCTTCAGGAGCCCCCTGG + Intergenic
1045476872 8:102560753-102560775 CAGGGGCTGCAGGGGCTGCAAGG - Exonic
1045476874 8:102560762-102560784 CAGGGGCTGCAGGGGCTGCAGGG - Exonic
1046398807 8:113676553-113676575 CTGCTGCTGCAGGGCCTGCATGG + Intergenic
1046659923 8:116938286-116938308 CAGGGGCTCCAGGGACTCCCAGG + Exonic
1047016099 8:120724935-120724957 CAGCTGCTCATGGGATTCCATGG + Intronic
1047393758 8:124475117-124475139 CTGCTGCTGCGGGGGCCCCACGG - Exonic
1047438723 8:124857549-124857571 CAGCAGCTCCAGTTGCTCAAGGG + Intergenic
1048448633 8:134511983-134512005 CATCTCCTCCAGGGCCTACAGGG - Intronic
1049040667 8:140110254-140110276 GAGCTGCTGCAGGGGGTGCAGGG - Intronic
1049040786 8:140110688-140110710 GAGCTGCTGCAGGGGGTGCAGGG - Intronic
1049040794 8:140110712-140110734 GAGCTGCTACAGGGGGTTCAGGG - Intronic
1049040833 8:140110832-140110854 GAGCTGCTACAGGGGTTGCAGGG - Intronic
1049040859 8:140110907-140110929 GAGCTGCTGCAGGGGGTGCAGGG - Intronic
1049040876 8:140110958-140110980 GAGCTGCTGCAGGGGCTGCAGGG - Intronic
1049093629 8:140535089-140535111 CAGCTGCTGCAGGGGCCGCATGG - Intronic
1049105268 8:140608793-140608815 CAGCTGCTCCAGGGCAGCAAGGG + Intronic
1049222662 8:141435014-141435036 CAGCTGCTATAGCAGCTCCAGGG - Intergenic
1049297210 8:141848520-141848542 CACCTGCTGCAGGAGCTCCAGGG - Intergenic
1049460786 8:142726803-142726825 CTTCTGCTCCAGGACCTCCAGGG - Intergenic
1049497335 8:142942422-142942444 CAGCTGGTCGAGGGGAGCCATGG - Intergenic
1049571134 8:143370793-143370815 CAGGGGCTGCAGGGGCTCCCGGG + Intronic
1049659510 8:143813487-143813509 CAGGTTCTCCCGGAGCTCCAGGG + Exonic
1049682382 8:143925306-143925328 CAGCTCCTCCAGGGCCTGCAGGG + Exonic
1049832766 8:144712907-144712929 CAACAGCCCCAGGGGCACCAGGG + Intergenic
1049917494 9:332769-332791 CAGCTGCTCAAGAGGCTGAAGGG - Intronic
1052057060 9:23918149-23918171 GTGCTGCTGCAGGGGATCCAGGG + Intergenic
1055375901 9:75648165-75648187 CAGCTGCTGCCAGGGCCCCAGGG - Intergenic
1056140872 9:83678421-83678443 CAGGTGATCCACTGGCTCCAAGG - Exonic
1056392045 9:86149573-86149595 GCGCTGCTGCAGGGGGTCCAGGG + Intergenic
1056604610 9:88076508-88076530 CAGGAGCTGCAGGGGCTCGAGGG - Intergenic
1057780467 9:98045808-98045830 CAGCTGCTCCAAGAGATCAATGG - Intergenic
1058447665 9:105068070-105068092 CCACTGCTCCAGTGCCTCCAAGG + Intergenic
1059436895 9:114282498-114282520 CAGGGGGTCCAGGGTCTCCAGGG - Exonic
1059657372 9:116368774-116368796 CAGTAGCTCCCTGGGCTCCATGG - Intronic
1060743849 9:126117061-126117083 CAGCTGCTCCGGGCCCTCCTGGG + Intergenic
1060827568 9:126695583-126695605 CCGCCCCTCCAGGGGATCCAGGG - Intronic
1060933830 9:127504747-127504769 CAACAGCTGCAGGGGCTCGAGGG + Intergenic
1061038049 9:128124394-128124416 CAGCAGCTCCACGTGCTCCCAGG + Intronic
1061207512 9:129173460-129173482 CTGCTGCGCCAGTGGCCCCAGGG + Intergenic
1061424630 9:130491323-130491345 GGGCTGCTCCGGGGCCTCCACGG + Intronic
1061537177 9:131257506-131257528 CAGCCACTCCAGGACCTCCAGGG + Intergenic
1061781488 9:132999065-132999087 CAGCTGGGGCAGGGCCTCCAAGG + Intergenic
1061874713 9:133537875-133537897 CTGCTTCTCCCGGGGCTCCCTGG - Intronic
1061885223 9:133587894-133587916 TATCTGCTCCAGGGGCTCCCAGG - Intergenic
1062133925 9:134914774-134914796 CTGCCTTTCCAGGGGCTCCAGGG + Exonic
1062151533 9:135021679-135021701 CAGCTGCTCCATGGTGTCCCAGG - Intergenic
1062401936 9:136376614-136376636 GAGCTGCTCCAGGCACTCCTGGG + Intronic
1062543038 9:137049912-137049934 CAGCTGCTGCAGGGTGGCCACGG + Exonic
1185460852 X:332245-332267 CAGCTGCTCAAGGCGCAGCAGGG - Intergenic
1186173092 X:6898160-6898182 CATGTGCTCCCTGGGCTCCATGG - Intergenic
1186896454 X:14008979-14009001 CAGCTGCACCGCGGCCTCCATGG + Exonic
1187297028 X:18012032-18012054 CAGCAGCTACAGCGGCTCCCTGG + Intergenic
1188156447 X:26748526-26748548 CAGCAGCTTCAGGGCCCCCATGG + Intergenic
1188212760 X:27443922-27443944 CAGCTGCTGCCTGGGCCCCAGGG - Intergenic
1188422111 X:30002992-30003014 CAGCTGCTGCAGGAGCTCTGTGG - Intergenic
1191216131 X:57933968-57933990 CAGCTGCTCTAAGGTCCCCACGG - Intergenic
1192737338 X:73861884-73861906 CAGCAGCTCCAGGGGCTGTTTGG + Intergenic
1194052059 X:89081101-89081123 CAGCTGCTCCAAGAGATCAATGG + Intergenic
1195375001 X:104218363-104218385 CAACTGCTCCAGTGGCAGCATGG + Intergenic
1195559183 X:106263861-106263883 CAGCTGCTCCAGGAGAGCAATGG + Intergenic
1195640837 X:107173025-107173047 GAGCTGCTCCACCTGCTCCAGGG + Intronic
1195884317 X:109624189-109624211 CAGCTGCTCCAGGGGCTGCCAGG - Exonic
1197064328 X:122220745-122220767 CAGCTGCTGCCTGGGCCCCAAGG + Intergenic
1199718650 X:150525802-150525824 CAGCTGCCCCAGGGCCTCATGGG + Intergenic
1200049016 X:153418611-153418633 CAGCTCCTCCAGGGGCCCAGGGG + Intronic
1200150152 X:153947315-153947337 CAGCTGCCCAAGGGGCTCTTTGG + Intergenic
1200268882 X:154662612-154662634 CAGCTGCAGCTGGGGCTACAAGG + Intergenic
1200286837 X:154830836-154830858 CAGCAGCTTCTGGGGTTCCATGG + Exonic
1200397494 X:155999676-155999698 CAGCTGCTTCTGGGGTACCAAGG + Intronic
1200915167 Y:8565032-8565054 CAGCAGCTCCTGAGGCTGCATGG - Intergenic
1200964715 Y:9025601-9025623 CAGCAGCTCCTGAGGCTGCATGG + Intergenic
1201472711 Y:14351693-14351715 GAGCTGCTGCAGGGGTTCCAGGG + Intergenic
1202148058 Y:21820737-21820759 CAGCAGCTCCTGAGGCTGCATGG - Intergenic