ID: 1002804311

View in Genome Browser
Species Human (GRCh38)
Location 6:557746-557768
Sequence AAGAGGGACCAGCCCTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002804302_1002804311 17 Left 1002804302 6:557706-557728 CCCAAGACTGTGAGAACATTGAT 0: 1
1: 1
2: 0
3: 17
4: 220
Right 1002804311 6:557746-557768 AAGAGGGACCAGCCCTTTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 126
1002804301_1002804311 18 Left 1002804301 6:557705-557727 CCCCAAGACTGTGAGAACATTGA 0: 1
1: 0
2: 1
3: 17
4: 293
Right 1002804311 6:557746-557768 AAGAGGGACCAGCCCTTTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 126
1002804300_1002804311 19 Left 1002804300 6:557704-557726 CCCCCAAGACTGTGAGAACATTG 0: 1
1: 0
2: 2
3: 51
4: 549
Right 1002804311 6:557746-557768 AAGAGGGACCAGCCCTTTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 126
1002804303_1002804311 16 Left 1002804303 6:557707-557729 CCAAGACTGTGAGAACATTGATG 0: 1
1: 0
2: 0
3: 31
4: 266
Right 1002804311 6:557746-557768 AAGAGGGACCAGCCCTTTGAAGG 0: 1
1: 0
2: 0
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002804311 Original CRISPR AAGAGGGACCAGCCCTTTGA AGG Intronic
900191324 1:1353492-1353514 AAGCGGGACCAGCCGCTGGAAGG + Intronic
900859500 1:5218034-5218056 ACCAGGGACCAGACCTGTGAAGG - Intergenic
903018032 1:20374451-20374473 AAGACAGACCAGCTCATTGAGGG - Intergenic
905807450 1:40887127-40887149 AAGAGGGAACAGCCCCTGGGTGG + Intergenic
907049138 1:51317974-51317996 CAGAGGGAAAAGCCCTTTCAGGG + Intronic
908127161 1:61043348-61043370 AGGAGGGACCTGGCCTTCGAAGG + Intronic
909277559 1:73708041-73708063 ATGAGGGACCACACGTTTGATGG - Intergenic
913073303 1:115320117-115320139 GAGAAGGACCAGGCCTTTGGTGG + Intronic
913274388 1:117122679-117122701 ATGAGGGACAAGCCCTTTGTGGG + Intergenic
920560831 1:206937256-206937278 AAGAGGGCCCCAGCCTTTGAGGG - Exonic
921169693 1:212535750-212535772 AATAGGGACCTGCCCTGTGCTGG - Intergenic
921552581 1:216555919-216555941 AAGTGCGACCAGCCCACTGAAGG + Intronic
922898543 1:229119075-229119097 CAGAAGGAACAGCCCTTGGAAGG + Intergenic
923634251 1:235679768-235679790 GAAAGGGACCAGCCTTTTGGAGG + Intronic
924661729 1:246025468-246025490 AAGAGGTACCAGTACTGTGACGG + Intronic
1066594355 10:37033196-37033218 AACAGGTACAAGCCCTTAGAGGG - Intergenic
1068881504 10:62054200-62054222 AAGAAAGCCCAGCCTTTTGATGG - Intronic
1070550973 10:77490392-77490414 AAGTGGCTCCAGCTCTTTGATGG + Intronic
1072671642 10:97434313-97434335 AGGAGTTACCAGCCCTTTCATGG - Intergenic
1074837563 10:117312321-117312343 AATAGGGACCAGGCCTGCGAGGG + Intronic
1077939429 11:6824783-6824805 CAGAGGGACCAGGTCTTTGGTGG + Intergenic
1084599423 11:70136114-70136136 ATGAGGGACCAGACCCTTGAGGG - Intronic
1085253220 11:75157188-75157210 AAGATGGATCAGCCCTTCAAGGG - Intronic
1085894104 11:80616675-80616697 AACAGGTACAAGCCCTTAGAGGG + Intergenic
1087004288 11:93453901-93453923 AAGAGAGAGCAGGCTTTTGATGG - Intergenic
1088959630 11:114650165-114650187 AAGAGGAACAAGCCCTTTCAGGG + Intergenic
1089077666 11:115751335-115751357 CAGACAGACCAGCCCTTTCAGGG + Intergenic
1089287450 11:117416875-117416897 AAGGGGGATCAGGACTTTGAGGG - Intergenic
1090357627 11:126150524-126150546 CAGAGGGACCAGCCCTGTCCGGG - Intergenic
1090481952 11:127076883-127076905 AAGAGGGTCAACCCCTTTTAGGG - Intergenic
1098525190 12:71479679-71479701 AAGAGGAGCCAGCCATTGGAAGG + Intronic
1100253164 12:92852701-92852723 AAGAAACACCAGTCCTTTGAAGG + Intronic
1100958908 12:99940798-99940820 AAGTGGGACCAGAGCTTAGAGGG + Intronic
1105688792 13:22814756-22814778 AAGAGGGAAGAGCTCTTTGTCGG - Intergenic
1106434159 13:29708886-29708908 CAGAGGGACCAGCCCTGAGAGGG + Intergenic
1108269971 13:48749919-48749941 AAGAGCGAACTGACCTTTGAAGG + Intergenic
1108420853 13:50248119-50248141 AAGAGGGACCAGACCCTACATGG - Intronic
1118322261 14:64760058-64760080 AAGAGGGCACAGCCCTTTTGGGG + Intronic
1121007458 14:90499495-90499517 AAATGGGACCCGCCCTTAGAAGG + Intergenic
1123940520 15:25214442-25214464 AAGAGGGACCATCCCATTCAGGG - Intergenic
1124690538 15:31817978-31818000 AAGAGGGAGCAGCTCTCTGACGG - Intronic
1125987660 15:44070927-44070949 AAGAGGGGCCAGACCTTTTTTGG - Intronic
1129337044 15:74858789-74858811 AAAAAGAACCAGCTCTTTGAAGG - Intronic
1129456237 15:75677405-75677427 ATGAGGGTCCAGCCCACTGAGGG + Intronic
1130097558 15:80867371-80867393 AAGAGAGACCAGGCTTTGGAGGG + Intronic
1138125661 16:54436418-54436440 AAGAGAGAGGAGCCCTTTGCTGG + Intergenic
1138606702 16:58094396-58094418 GACAGGGACCTGCCCTTGGAGGG - Intergenic
1140310056 16:73840349-73840371 CAGTGGGACCACCCCTTTAATGG + Intergenic
1140964956 16:79956894-79956916 AACAGGAACAAGCCCTTTGCTGG - Intergenic
1141313444 16:82937127-82937149 AAGAGGGAACAGGCGTTTGTGGG - Intronic
1142105186 16:88298874-88298896 AAGAGGGATCACCCCTCAGAGGG - Intergenic
1143820992 17:9562813-9562835 AAGAGTGACAACCCCTTTGAGGG + Intronic
1144698758 17:17323087-17323109 CAGAGGGTCCAGCCCTGTGAAGG + Intronic
1145867466 17:28250290-28250312 GGGAGGGACCAGTCCTTCGATGG - Intergenic
1148211474 17:45811258-45811280 AACAGGTAAGAGCCCTTTGAAGG - Intronic
1150461924 17:65360783-65360805 GAGAGGGACCAGCCCCCTCAGGG + Intergenic
1155272436 18:24153605-24153627 AAGAGGAACCAGCCCCTCCAGGG - Intronic
1159619787 18:70623712-70623734 AAGAGGAACTAGCCCTTGAATGG - Intergenic
1162732746 19:12728832-12728854 AAGAGGGCCCAGCCCTAAGCTGG + Intergenic
1163277858 19:16296771-16296793 CACAGGGACCCGCCCCTTGAAGG + Intergenic
1165774472 19:38396462-38396484 AACAGGGACCTGCCCTTTTCGGG - Intergenic
1165825573 19:38703870-38703892 GAGAAGGACCAGCCAGTTGAGGG + Intronic
1167970074 19:53183770-53183792 CAGAGGGACCACCCATGTGAAGG + Intronic
927964604 2:27261544-27261566 AAAAGGGAGCAGCCTGTTGATGG - Intronic
928181946 2:29074129-29074151 AAGAGGTTCCATCCCTTTGCTGG - Exonic
929510415 2:42562104-42562126 AAAAGGGGGCAGCCCTGTGAAGG - Intronic
932490658 2:72117929-72117951 AGGAGGGGCGAGCCCTTTGCAGG + Intergenic
932769615 2:74493159-74493181 AGGATGTCCCAGCCCTTTGAAGG - Exonic
935172083 2:100618034-100618056 AGGAGAGACCAGGCCATTGAAGG + Intergenic
940360726 2:152793131-152793153 GGTAGGGACCATCCCTTTGAGGG + Intergenic
943954050 2:194163027-194163049 AAGAGGGGTCAGCCCACTGAAGG - Intergenic
1171161450 20:22928056-22928078 AAAAGGGACCAGTCCCTAGAAGG + Intergenic
1176043929 20:63082780-63082802 AAGAGAGAGCAGCCCATGGAGGG - Intergenic
1176649385 21:9531132-9531154 AATGGGAACCAGCCCTTTGGTGG + Intergenic
1177505387 21:22012920-22012942 ATGATGGAACAGCCTTTTGAAGG - Intergenic
1179251566 21:39675164-39675186 AGGAGGAACCAGCCCTGTGACGG - Intergenic
1180614509 22:17119126-17119148 CAGAGGTACCAGCCCCTTGGAGG + Exonic
1183345164 22:37303445-37303467 AGGAGGGACCTGTCCTTAGATGG + Intronic
1183355902 22:37359321-37359343 AAGAAGGACCAGGCCAGTGAGGG - Intergenic
1184340073 22:43881171-43881193 AAGAGGGACCAGGCCACTGCAGG + Intronic
1184521433 22:44996513-44996535 GAGAGGGAGCAGCCCTTTCATGG - Intronic
949521117 3:4854882-4854904 AAGAGGGTCAATGCCTTTGAGGG + Intronic
950094172 3:10318828-10318850 AAGAGAGTCCAGCCATTTGAGGG - Intronic
950704152 3:14769723-14769745 AAGGAGGACCAGCCCTCTGGTGG + Intronic
953590079 3:44242542-44242564 AACAGGGAACACCCCTTTTAAGG - Intronic
955587771 3:60499777-60499799 AGGAGGGACCAGCCCATTGTGGG - Intronic
962975204 3:140440172-140440194 GAGAAGGACCAGCCCTAGGAAGG + Intronic
965163884 3:165169810-165169832 CAGTGGGAGCAGCCCTTGGAGGG - Intergenic
968781839 4:2588274-2588296 AAGAGGCACCAGAACTTTCACGG - Intronic
974528564 4:63077351-63077373 AAGTGGGTGCAGCCCTTCGAGGG - Intergenic
976028187 4:80717254-80717276 AAGGGAGACCATCCCTTTTAGGG - Intronic
976338714 4:83921020-83921042 AAGAGGGATCAGCACATTGGAGG + Intergenic
981129646 4:141143824-141143846 AAGAGGCATTAGTCCTTTGAAGG - Intronic
984490592 4:180430358-180430380 AAGAGAGACCAGGCCTTCCATGG - Intergenic
986595360 5:9416388-9416410 GTGTGGGACCTGCCCTTTGATGG - Intronic
987459458 5:18190772-18190794 AAGAGGGAGCAGCCATTATATGG + Intergenic
987714946 5:21556400-21556422 AAGCTGGACTTGCCCTTTGAGGG - Intergenic
989151680 5:38306252-38306274 AAGAGAGAGCATCACTTTGAAGG + Intronic
992671156 5:79062432-79062454 AAGAGGGAACCTCACTTTGAGGG - Intronic
993253461 5:85556909-85556931 AAGAGGGACCTGACTATTGAAGG + Intergenic
996287624 5:121813270-121813292 AAGAGGGACCTGACCATTGGGGG - Intergenic
997570230 5:134921639-134921661 GAGAGGAACAAGCCATTTGAAGG - Intronic
999577119 5:152991437-152991459 AAGATGGAGCAGCTATTTGAGGG + Intergenic
1001233366 5:170009017-170009039 AAGAGGGACCAGGACTGTCATGG + Intronic
1002370929 5:178753762-178753784 AAATGACACCAGCCCTTTGAAGG - Intergenic
1002804311 6:557746-557768 AAGAGGGACCAGCCCTTTGAAGG + Intronic
1004934225 6:20491712-20491734 AACAGGGAGCAGCCCTGTGTCGG + Exonic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006415014 6:33898413-33898435 AAGGAGGAGCAGCCCCTTGAGGG - Intergenic
1008584884 6:52939538-52939560 AACAGGGACCAGCAATTTGCAGG - Intergenic
1009001775 6:57725632-57725654 AAGCTGGACTTGCCCTTTGAGGG + Intergenic
1010650350 6:78447410-78447432 GAGAGGGTCCTGCTCTTTGATGG - Intergenic
1015555764 6:134459795-134459817 ACAAGGGAGCAGCCCTTTTAGGG - Intergenic
1015728600 6:136324933-136324955 TACAGGGACCAGCCATTTGTAGG - Intergenic
1018246120 6:161825801-161825823 AACTTGGACCAGCCCTCTGAAGG - Intronic
1018396163 6:163379590-163379612 GAGAGGGAACAGCGCTCTGAGGG - Intergenic
1018632497 6:165833424-165833446 AGGAGGCACCTGCCCTTTGCAGG + Intronic
1022539653 7:31123905-31123927 AAGAGTGCCCAGCTCATTGAAGG - Intergenic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1026286418 7:68967264-68967286 AAGAGAGACTAGCCCTTTTAGGG + Intergenic
1029280025 7:99429538-99429560 ACGTGGGACCAGCCCCATGAAGG + Intronic
1032167885 7:129559854-129559876 AAGAGGGAGCAGCCTTATCAGGG + Intergenic
1033887488 7:145966715-145966737 AAGTGGGAGCAGCCCTCAGAGGG + Intergenic
1034282817 7:149865572-149865594 AAGACGGAGCTGCCCTTGGAAGG - Exonic
1037356997 8:18031110-18031132 AAGAGGAACCACCCCATTCAGGG - Intergenic
1037406441 8:18547449-18547471 AAGAGGGACTACCCCCTTGAGGG - Intronic
1037918438 8:22787118-22787140 AGAAGGGACCAGCCCTTAGCTGG - Intronic
1039888644 8:41669919-41669941 CAGAAGGCCTAGCCCTTTGAAGG - Intronic
1049373447 8:142278406-142278428 AAGCAGGACCAGCTCCTTGAGGG - Intronic
1053072039 9:35107483-35107505 AAGAGGGGCCAGCCCCTCGGAGG - Exonic
1058869523 9:109190356-109190378 AAGAGGAAGCAGCCCTTTACGGG - Intronic
1059450828 9:114370574-114370596 CAGAGAGACCAGCCCTGGGAGGG - Intronic
1060279087 9:122204022-122204044 AAGAGGCACTAGCCATTTTAAGG - Exonic
1203627126 Un_KI270750v1:34680-34702 AATGGGAACCAGCCCTTTGGTGG + Intergenic
1189030708 X:37446813-37446835 AAGAGGGACCAGACCTGAGGAGG + Intronic
1190627497 X:52350861-52350883 TAGAGGGACCATCCCCTTCAGGG + Intergenic
1190700309 X:52983287-52983309 TAGAGGGACCATCCCCTTCAGGG - Intronic
1192316059 X:70052816-70052838 AAGAAGGAGGAGACCTTTGAGGG + Intergenic
1194669724 X:96716598-96716620 AAGAGGTATAACCCCTTTGAGGG - Intronic
1200397373 X:155999124-155999146 ATGAAGGACCAGGCCTGTGATGG + Intronic
1200679575 Y:6194354-6194376 AAGGGCTACCAGCCCTATGAAGG + Intergenic